The Mirage of “Scientific” Atheism

July 16, 2012 2:55 pm 207 comments

The battle between atheist activists and believers continues to escalate in our society. Any doubt about the truth of this assertion should quickly dissipate with a quick sampling of recent headlines that appeared on a conservative website, The Blaze, in the six weeks between the end of May-July 9, 2012:

Edwina Rogers, former D.C. lobbyist, is the Executive Director of Secular Coaltion of America

  • Atheist Billboard in TX Quotes JFK‘s “Absolute” Separation of Church & State’ Speech
  • VA High School Agrees to Remove 10 Commandments in Settlement With ACLU
  • Federal Judge in New York Rules With Religious Groups for Access to Public School Space
  • Police Chaplains Banned From Praying in Jesus’ Name at Public Events
  • Atheists Appeal to Obama Admin, Calling Faith-Based Birth Control Exemptions ‘Gov’t Endorsement of Religion’
  • CNN Panel Debates Why America‘s Youth Are Allegedly Beginning to Doubt God’s Existence
  • Atheist Victory? Supreme Court Refuses to Hear War Memorial Cross Case
  • Atheist Group Demands Removal of Select Military Bibles & Calls Them a ‘Threat to National Security’
  • Blaze Exclusive: Atheist Activist Answers Your Questions About ‘Repulsive’ Bible Scriptures & the 10 Commandments
  • Atheist Family Loses Lawsuit to Have ‘Under God’ Removed From the Pledge of Allegiance
  • Atheists Praise Latest Victory: 60-Year Nativity and Religious Display Tradition Banned in Santa Monica
  • Atheists Begin Organizing High School Campus Clubs for Teens
  • Meet the New Atheist Group That Promises to ‘Amplify the…Influence of Non-Religious Women’
  • Atheist Lobbyists Launch Massive Effort to Organize for Political Power in All 50 States

The particulars of these stories or the principles of constitutional law that are involved in the legal challenges are beside the point. What is clear is that we are surrounded on all sides by a profound ideological conflict; in our courtrooms, in our classrooms, and among leading intellectuals. At stake are the hearts and minds of the American people and with them the soul of our nation. There is an enormous spiritual gulf between a nation that views human life as reflecting a transcendent, sacred reality, that cherishes the concept that all men are created equal and have been endowed by their Creator with unalienable rights and one that believes that homo sapiens are essentially highly developed bacteria or chimpanzees that evolved through an unguided, purposeless process. It is one or the other; there is no middle ground here.

There is an ideological battle raging in American society today

The trump card that is consistently and triumphantly played by most modern “militant” atheists is Science. They claim that it is the non-believer who stands on solid rational and scientific ground, while the believer is mired in the quicksand of superstition, wishful thinking, and leaps of faith.

The foundation stone upon which rests the entire edifice of a science-based atheistic world view is the truth of Darwinian evolution. Before Darwin’s Origin of Species was published in 1856 the Argument from Design which focused on the wonders of the living world – an argument which was masterfully articulated by the Reverend William Paley in his famous watchmaker analogy and by other theologians/philosophers – was the undeniable evidence for the existence of a Creator of life. This point is openly acknowledged by the leading proponent of atheism in the 21st century, Professor Richard Dawkins. In his best-selling treatise about evolution, The Blind Watchmaker, Dawkins writes the following (page 5):

“Paley’s argument is made with passionate sincerity and is informed with the best biological scholarship of his day…one thing I will not do is belittle the wonder of the living “watches” that so inspired Paley…when it comes to feeling awe over living “watches” I yield to nobody. I feel more in common with the Reverend William Paley than I do with the distinguished modern philosopher, a well known atheist, with whom I once discussed the matter at dinner. I said I could not imagine being an atheist before 1856 when Darwin’s Origin of Species was published…Paley knew [the organized complexity of the living world] needed a special explanation; Darwin knew it, and I suspect that in his heart of hearts, my philosophical companion knew it too.” [emphasis mine]

Dawkins is doing nothing more than stating the obvious. The awe inspiring complexity of every aspect of the living world is, at first glance, a glorious testimony to a Creator. This is not in dispute. The atheist simply claims that while living organisms may appear to be products of design and designer, modern biology has discovered that what we are actually seeing is an illusion of design. This illusion is the result of Darwinian evolution. Elsewhere Dawkins writes, “Charles Darwin discovered a way in which the unaided laws of physics could, in the fullness of geological time, come to mimic deliberate design.” [emphasis mine] Ergo: The Blind Watchmaker.

In fact, a careful examination of scientific realities will reveal that not only is Darwinian evolution totally irrelevant to the question of the existence of  God the Creator – even if we concede it’s truth for arguments sake – but that the Argument from Design has yet to be challenged in any serious manner by modern science. The argument is still as compelling today as it was in the first decade of the 19th century when presented by Paley or as it was 2000 years ago when presented in a different form by the great Talmudic sage, Rabbi Akiva, in his response to a challenge by a Roman skeptic. Ironically, it is the great scientific breakthroughs achieved by 20th century researchers that have shattered the myth of the evolutionary basis for scientific atheism.

Reverend William Paley (1743-1805); His book, Natural Theology, published in 1802, contained his famous watchmaker analogy.

Darwinian evolution is based on the accumulation – over millions, tens of millions, and hundreds of millions of years – of beneficial random mutations in the replication of DNA, starting with the simplest living organisms known to have ever existed: microscopic bacteria measured in the millionths of a meter. The crucial point for our discussion is that the evolutionary process requires a pre-existing living organism with a fully functioning DNA-based, digital-information storage, translation, and self-replication system. This system is, in the words of Dawkins himself (River Out of Eden), the “universal system for all life on the planet,” is “uncannily computer-like,” can “rival anything modern engineers can do,” and is “digital to the core.”

Evolution is only operative and relevant from this point forward. It is an undisputed scientific fact that Darwinian evolution does not in any way address the question of how the original bacteria came to be in the first place. That question is the domain of a fundamentally and conceptually separate area of science called Origin of Life research. Generally speaking, evolution falls in the category of biology, which is the study of living things. The essential scientific discipline required for Origin of Life research is chemistry; in other words, how did the original non-living, non-organic chemicals coalesce and form the first bacterium and its genetic code.

The gulf between naturally forming organic material (such as amino acids) and a living bacterium is enormous. Let us imagine that the bacterium is a mud hut with a straw roof in a clearing in a jungle. Mud, straw, and rocks are available everywhere. The task of Origin of Life researchers would then be to figure out the purely naturalistic, unguided process that transformed mud, rocks, and straw into a habitable mud hut. Even this grossly understated analogy brings into focus the stupendous problem that these researchers face. A more accurate portrayal would be the following: naturally forming organic chemicals might bear some resemblance to bricks; a bacterium resembles the palace at Versailles in its full splendor. In the words of the late Dr. Robert Shapiro, renowned Origin of Life expert, and Professor Emeritus of Chemistry at NYU, “A mixture of simple chemicals, even one enriched in a few amino acids, no more resembles a bacterium than a small pile of real and nonsense words, each written on an individual scrap of paper, resembles the complete works of Shakespeare.” So what do Origin of Life researchers have to say about how all this happened? What they tell us is, in my opinion, exactly what one would expect to be the result of an investigation into how a highly complex piece of machinery could have emerged through an unguided process. In the words of Origin of Life expert, Dr. Paul Davies: “We haven’t a clue.”

The Palace of Versailles

It is clear then that Darwinian evolution (again, even conceding its truth), is not a testimony to what can result from unguided natural processes. It is a testimony to the unimaginable capabilities and potential contained in the first living cell and its genetic code. As the distinguished (non-believing), professor of philosophy at NYU, Thomas Nagel, wrote in his review of Dawkins’ atheistic magnum opus, The God Delusion, “The entire apparatus of evolutionary explanation therefore depends on the prior existence of genetic material with these remarkable properties…we have explained the complexity of organic life in terms of something that is itself just as functionally complex as what we originally set out to explain. So the problem is just pushed back a step: how did such a thing come into existence?” Quite a good question as far as I’m concerned.

Where does this leave us? It leaves us right back in 1855, the year before Darwin’s book was published. We find ourselves facing a fully functional, highly sophisticated, living molecular machine with a digitally controlled self-replicating system that is functionally complex at a level beyond anything modern technology can produce…and no idea at all where it came from. However one chooses to interpret these facts one thing is clear; the vision of some impregnable atheistic/scientific fortress looming large on the horizon is truly a mirage. 

If in American society today a battle regarding the existence of God the Creator is unavoidable, then by all means, let the games begin. However, let the discussion be an honest one with a level playing field.

Rabbi Moshe Averick is an orthodox rabbi, a regular columnist for the Algemeiner Journal, and author of Nonsense of a High Order: The Confused and Illusory World of the Atheist. It is available on Amazon.com and Kindle. Rabbi Averick can be reached via his website. If you wish to be informed when new articles appear, send an email to moe.david@hotmail.com with the email address and the word “Subscribe” in the subject line.

207 Comments

  • God is a hypothesis and prayer is nothing but self hypnosis. It takes two to cration therefore if the thiests claim a diety it should also have parents, only amoebas self create themselves, as the human species also shall evolve and get extinct as other 20,000 species of plants, animals and insects get vanished every year. The sun shall die and the milky way shall merge with the nearest galaxy andodomedia and the so called idealists would be helpless as their so called god and prayers wont save them, All civilisations , cultures, languages,nations, races and religions end after a brief period of time as history is our best teacher.

  • [][][]
    ayla
    July 24, 2012
    11:38 pm
    “Going back in time, the entropy of the universe decreases. There was a point of zero entropy, absolute zero, a beginning point.”
    [][][]

    If you assume that the universe had a beginning, then you can easily imagine “going back in time” with “decreasing entropy” to that “absolute zero entropy” beginning.

    However, assuming your point does not prove it, not even the possibility of it. Assuming a miraculous “something from nothing beginning” (a miraculous “point of zero entropy”) is not a reasonable assumption.

    Don’t forget the First Law of Thermodynamics: energy cannot be created. (C. P. Snow had an interesting take on it when he described it as “you cannot get something for nothing.”)

    And then, what about the Third Law of Thermodynamics stating that zero entropy is impossible?

    • No need to assume anything when evidence points to a beginning.
      Regarding First Law of Thermodynamics (FLT), without exception, we observe that new energy is not created by any natural means, it only changes form. Therefore at singularity, either matter/energy exists infinitely (which Second Law of Thermodynamics says cannot be true) or it is formed by some means, and FLT says it cannot be created by any natural means. If natural means did not create matter/energy, then something not natural – or supernatural – must have, logically, created it.
      One of two things must be true:
      1)Matter/energy is infinite (SLT says this is not true)
      2)A force capable of creating matter/energy and the physical laws must exist infinitely.
      As for Third Law of Thermodynamics, a singularity is the most ordered form of matter possible, with zero entropy.

      • [][]” If natural means did not create matter/energy, then something not natural – or supernatural – must have, logically, created it.”[][]

        The supernatural is impossible, so, naturally, logically, matter/energy was not created.

        There is certainly no evidence pointing to a beginning (to “Creation, by God!).

        • [][]“As for Third Law of Thermodynamics, a singularity is the most ordered form of matter possible, with zero entropy.”[][]

          So your contention is that the Third Law of Thermodynamics is false? And so is the First Law?

          This is the new physics?

        • I’ll end it with this observation: You have absolutely no way of knowing that the supernatural is impossible. It’s simply a belief of yours.

          • You have absolutely no way of knowing that the supernatural exists (or is even possible). It’s simply a article of blind faith for you.

            So we both have beliefs. The crucial difference is that your belief in the supernatural is blind (since the supernatural is impossible to observe), while my belief in nature is the opposite, i.e., not blind (being based on that which is not impossible to observe).

          • Religious faith is a cognitive dead end, ayla, so your argument basically ended as soon as you tried to begin it.

  • Atheism is a negative position; it simply means NOT believing in God, which leaves it entirely unknown what any particular atheist does believe.

    There is nothing scientific about either theism or atheism.

    Theism is anti-scientific, since it is about believing in the supernatural. Atheism is non-scientific, since it isn’t about believing anything.

  • [][]
    Moshe Morris
    July 23, 2012
    2:23 pm

    “I think it is not only perfectly logical, but that the natural world that we observe indicates that that is true.”
    [][]

    I’m not sure what you are thinking is “perfectly logical” and also follows from the evidence of “the natural world.”

    It almost sounds like you a trying to say that you think I’m right even though you feel I’m wrong.

  • [][]

    Moshe Morris
    July 23, 2012
    2:23 pm

    “I think it is not only perfectly logical, but that the natural world that we observe indicates that that is true.”
    [][]

  • For some reason, I want to give it one more try.

    Do you agree that there are secular scientists (some of whom are even atheists) who based on secular, scientific reasoning came to the conclusion that once there was no universe – i.e., no space, no time, no matter, no energy?

    Moshe

    • No, I don’t agree. Imagining a “something from nothing miracle” is NOT scientific reasoning (no matter who does it — or what mathematical excuses they might claim to have).

    • “For some reason, I want to give it one more try.”

      Trying to reason with Stoddard is like viewing a bad auto accident. You know it’s gonna be ugly but you just can’t turn away. He thinks he sounds smart by repeatedly invoking the 4-term fallacy that he probably read off Wikipedia. I can’t imagine it was readily available in his limited intellectual arsenal.

      • It’s not hard to understand why believers caught up in the wreck of theism would prefer to feel that adhering to the rules of logic “sounds smart,” but is really dumb.

        When you wish to believe in “Creation, by God!” logic is not your friend. So sticking to logic would seem like having a “limited intellectual arsenal.” Religious faith seems to open such vast vistas beyond reality and logic.

        • Steve: since you and logic are such tight friends, how about applying logic to your contention that the universe had no beginning. As discussed in my last comment to you about the Second Law of Thermodynamics, the entropy of the universe is increasing. Going back in time, the entropy of the universe decreases. There was a point of zero entropy, absolute zero, a beginning point. The temperature of the universe is now measured at 2.725 K, remnants of the Big Bang, photons, have cooled to this temperature. All this points very logically to a beginning of the universe. It is not infinitely old.

          • If you assume that the universe had a beginning, then you can easily imagine “going back in time” with “decreasing entropy” to that “absolute zero entropy” beginning.

            However, assuming the point does not prove it, not even the possibility of it. Assuming a miraculous “something from nothing beginning” (a miraculous “point of zero entropy”) is not a reasonable assumption.

            Don’t forget the First Law of Thermodynamics: energy cannot be created. (C. P. Snow had an interesting take on it when he described it as “you cannot get something for nothing.”)

            And then, what about the Third Law of Thermodynamics stating that zero entropy is impossible?

  • [][][]

    Moshe Morris
    July 23, 2012
    2:23 pm
    “… you hold the observable universe to be the totality of reality …”
    [][][]

    Not exactly.

    I actually think the universe existed even before there was anyone around to observe it. Not only that, there are plenty of things about the universe which we cannot directly observe.

    I will grant you that there was a time when nothing in the universe was observed. But you cannot reasonably take that as meaning that once upon a time nothing existed.

  • [][]
    Moshe Morris
    July 23, 2012
    2:23 p.m.

    “I think we obviously have hit an impasse”
    [][]

    It’s called reality.

    It can take some getting used to.

    It’s not highly thought of by theists, but it is impossible to get away from. Blind (i.e., religious) faith can obscure your view of it, but cannot make it go away, or change its nature.

  • [][]
    Moshe Morris
    July 22, 2012
    4:53 pm

    “So use a different term.”
    [][]

    Do you understand what the “four term” fallacy is?

  • [][]

    Moshe Averick
    July 17, 2012
    12:00 am

    ‘Hydrogen and Oxygen are not “codes” that represent ideas, instructions, or information.’
    [][]

    True. Strictly speaking, neither is DNA “code” that represents ideas, instruction, or information.

    Code is a human invention. Water and DNA were around long before the invention of ideas, instructions, information, and code.

  • To Steve Stoddard:

    Please note this quote from Janna J. Levin [PhD in Theoretical Physics from MIT — assistant Professor in Astronomy and Physics at Barnard College (source http://en.wikipedia.org/wiki/Janna_Levin):

    “The simplest picture of the Big Bang starts with nothing – there’s really nothing. there’s no space, there’s no time, there’s no matter, there’s no energy. It’s nothing but the potential to exist. And out of that bursts the universe. Time starts, space is created. All the matter and energy of the universe is born at that moment…

    The Big Bang is often misunderstood as an explosion in space, as if space existed and time existed and there was just this explosion of matter and energy into space. But something much more profound than that is going on. And that is that space itself is created in the Big Bang and time is create in the Big Bang.

    The Big Bang describes the origin of the entire universe…”

    [Source: http://youtu.be/zV6aQbnHSRo

    She is not giving a ‘religious’ interpretation of the Big Bang – she is giving a scientific/physists explanation of the Big Bang.

    So, I ask you again – can you grant Premise #1 – that space, time, energy and matter once did NOT exist and now it does exist – at least according to the Big Bang theory.

    • [][]“The Big Bang describes the origin of the entire universe…”[][]

      Whether you call it “Creation Science” or “Big Bang Science,” that is the same religious notion that the universe depends on something unnatural, a miracle.

      In my opinion, the notion of “Creation, by God!” — or “Creation by Bang” — is senseless and illogical.

      Note that I am judging this on the issue of WHAT is being said, not on WHO happens to be saying it.

      [][]“So, I ask you again – can you grant Premise #1 – that space, time, energy and matter once did NOT exist and now it does exist …”[][]

      Okay, then I shall answer again: I do not think that there ever existed a time or place when or where “space, time, energy and matter once did NOT exist.”

      You may feel that you have been there, or seen that, or heard a plausible story about it, but frankly I don’t buy it.

      I think it is a senseless notion to believe that you can find evidence anywhere in the world that there was ever a place where time didn’t exist, or a time when no places existed, or whatever it is exactly that you are trying to argue for about the non-existence of everything. That notion is purely one of blind (i.e., religious) faith. Cognitively, there is nothing to it.

      My premise is that existence does exist — and there is no alternative. That is, the supernatural is impossible — never happened, never will; you cannot find it, you can only imagine it. (And no matter how popular it is to fantasize about the supernatural, no matter who does so or what they call it, it remains as always: fiction. Very gruesome fiction in some aspects, glorious in others — especially in music — but fiction nonetheless.)

      • Hello Steve,

        Well, I have to admit, you are consistent and I commend you for that.

        I think we obviously have hit an impasse – you hold the observable universe to be the totality of reality and think that any other option is inherently illogical.

        I think it is not only perfectly logical, but that the natural world that we observe indicates that that is true.

        I think we’ll leave it at that and I wish you well.

        All the best,

        Moshe

        • It looks like you are trying to make us forget about the rest of your fallacious argumentation, e.g., that four-term trick you tried to pull.

          Just remember, there is a lot more wrong with your attempts at argumentation than simply one false premise.

          No matter which way you try to slice the arguments, you can only get to “Creation, by God!” through blind (i.e., religious) faith. There is nothing of evidence, logic, reason, and reality to theism.

          Theism is beyond and without real life. To believe in God requires sacrifice.

      • Steve: The Second Law of Thermodynamics disagrees with you. The universe is in a state of increasing entropy, constantly losing usable energy. Tracking backwards in time, usable energy increases, entropy decreases. There was a point of zero entropy, a beginning.

        • If you assume that the universe had a beginning, then you can easily imagine “tracking backwards in time” to that beginning.

          However, assuming the point does not prove it, not even the possibility of it. Assuming a miraculous “something from nothing beginning” puts you on the wrong track (forwards or backwards).

  • [][][]” I didn’t even mention God. I used the word ‘entity’ (a very pareve, neutral word) – and only then in the conclusion.”[][][]

    That is one of the big reasons why your argument is not logical. The conclusion cannot follow from the premises if you put a new term in the conclusion that wasn’t in the premises.

    That is known formally as the “four term fallacy.” (Not the “fifth wheel fallacy” I mentioned earlier.)

  • []“… the idea of an entity independent of the universe that we live in …”[]

    is pure fantasy.

    There is nothing reasonable about such an idea, since it is not logically derived from evidence in reality.

    Notice how you have it set up so that it couldn’t possibly be dependent on any actual evidence.

  • To Steve Stoddard,

    I have an idea. Let’s take this one premise at a time.

    Let’s start with the first premise. I am going to phrase it as follows:

    The universe once did not exist and now does exist.

    Do you agree or disagree with that premise? If you do not agree, please explain why.

    Be well,

    Moshe

    • The universe DOES exist.

      To claim that you know of a time when it didn’t is sheer fantasy.

      Even believing in the possibility of such a “time of nothingness” (and a miraculous “something from nothing” process) is unreasonable.

      • So you disagree with modern physics and the Big Bang theory?

        • Whenever something goes “bang,” it is always something that goes “bang.”

          The notion of an origin of the universe makes no sense. The belief that nothing exploded miraculously into something is pure fantasy.

          Even if there was some sort of “Big Bang” such as “modern physics” goes on about, it could not have been the “beginning of the universe, ex nihilo.” It could only have been yet another ongoing part of nature.

          • You can claim that and state it all day long, but let’s just deal with the Big Bang theory for now and not your claims of how to explain it.

            Did you watch the video? Did you see what they said about the beginning of space and time? [we'll get to their possible explanations if and when we get to premise #2].

            The Big Bang theory claims that there was no space, no time, and that space, time and the universe then came into existence.

            Do you agree that the physicists in the video link I sent states that?

            [note, I have ten more minutes until I leave - so we may have to continue tomorrow]

          • []{}[]“The Big Bang theory claims that there was no space, no time, and that space, time and the universe then came into existence.”[]{}[]

            What you are presenting there, Morris, is the religious fantasy version of “The Big Bang.” That is not an empirically, rationally sound theory.

            The extent to which you invoke non-existence for a theory is the extent to which it is wrong (at the least).

  • [][][]
    Moshe Morris
    July 19, 2012
    4:42 pm

    “Who says that God is an impossibility?”
    [][][]

    I, for one, have pointed it out a few times.

    [][]“There is nothing illogical or impossible about the idea of a creator.”[][]

    Unless you are talking about a “supernatural” Creator (aka “IDOL“). Then you are talking “illogical and impossible.”

    • To Steve Stoddard:

      A Logical Conclusion:

      1) The natural world was created (i.e., Big Bang Theoery)
      2) The natural world is incapable of bringing about its own creation
      3) Therefore – there is an entity independent of the natural world which brought the universe into existence

      Another logical Conclusion:

      1) The natural world exhibits sophisticated, complicated, and integrated design

      2) The laws and properties of the natural world seem incapable of creating such sophisticated, complicated and integrated design

      3) Therefore – there is an entity independent of the laws and properties of nature which brought about that sophisticated, complicated, and integrated design

      What is illogical is to accept premises one and two above and claim that the idea of an entity independent of the natural world is illogical or impossible. You have merely DECIDED that such an entity is impossible and you are willing to ABANDON both LOGIC and SCIENCE to maintain your BASELESS decision.

      Furthermore, your definition of an idol is off. An idol is bestowing divine or supernatural powers on a PHYSICAL object (http://en.wikipedia.org/wiki/Idol). G-d, by definition, is NOT an idol because G-d is BEYOND the PHYSICAL world, INDEPENDENT OF IT.

      If you want to INTELLIGENTLY join this conversation (something that I would like for you), then you need to TAKE THE TIME to LEARN basic science and theology.

      Do not think that you can come to an intelligent, rational conclusion on such an important issue without having the requisite understanding of the issues that you are discussing.

      • Sound logical arguments require premises which are true. (And syllogisms require three, and only three, distinct terms.) You have given two examples here, each of which contains at least one false premise.

        Paraphrasing your first example:

        1. The natural world was created.
        2. The natural world could not create itself.
        3. Somebody Else made that happen.

        A further refinement:

        1. Nature was created.
        2. That couldn’t happen naturally.
        3. Therefore, nature was created by God.

        Your argument amounts to this:

        1. Nature was created.
        2. Only a Supernatural God could create nature.
        3. Therefore, nature was created by a Supernatural God.

        No matter how you slice it, you fail to have a sound argument.

        1. Nature was created.
        2. Nature was created by God.
        3. Therefore, nature was created by God.

        To make a long story short:

        Your first premise is false.

        Your second premise is nothing more than your conclusion.

        (It’s sort of like you look at God as jumping in there as fourth term, or maybe a fifth wheel.)

        • To Steve Stoddard,

          It is true that if you give a false paraphrasing of my argument that it will fail to hold up. So let’s go through CAREFULLY what I said and analyze it HONESTLY.

          Your first paraphrase is fine – although I wouldn’t use the phrase SOMEBODY ELSE because it implies some sort of person-like entity. I would use a phrase like an independent force or independent entity which has a less anthropomorphic connotation.

          Either way, so far so good.

          You then further refine my argument and here things start to go off although for the most part things are still fine.

          I wrote:

          The natural world is incapable of bringing about its own creation

          You ORIGINALLY paraphrased:

          The natural world could not create itself

          In both these versions the emphasisis is on whether or not the natural world has the ability to bring forth its existence from non-existence. In your refinement you write it as follows:

          “That couldn’t happen naturally”

          This is a bit off. The question is whether or not the natural world has the capability of bringing about its own existence from non-existence. I’m not sure exactly what ‘couldn’t happen naturally’ means, but it does NOT seem to mean what I said.

          Let’s look at a similar argument:

          1) Shimon was born
          2) Shimon is incapable of giving birth to himself
          3) Someone independent of Shimon must have given birth to him

          It’s the same point about the universe. The universe once didn’t exist. Now it exists. If the universe does NOT have the ability to bring itself into existence then some entity independent of the universe must have done so.

          Either way, your final rephrasing of my argument is totally off. Premise number two in NO WAY amounts to my saying ‘only a supernatural G-d could create nature’. I didn’t even mention G-d. I used the word ‘entity’ (a very pareve, neutral word) – and only then in the conclusion. The second premise is about the capabilities of the natural world given the fact that it once didn’t exist and now does.

          So my point stands – the idea of an entity independent of the universe that we live in is totally logical and reasonable and flows directly from the two premises that I correctly stated.

          • [][]” I didn’t even mention God. I used the word ‘entity’ (a very pareve, neutral word) – and only then in the conclusion.”[][]

            That is one of the big reasons why your argument is not logical. The conclusion cannot follow from the premises if you put a new term in the conclusion that wasn’t in the premises.

          • []“The universe once didn’t exist. Now it exists. If the universe does NOT have the ability to bring itself into existence …”[]

            Certainly the universe “does NOT have the ability to bring itself into existence.” It doesn’t need such a fantasy bootstrapping ability, of course, since it already does exist — and never didn’t exist.

          • [][]“The question is whether or not the natural world has the capability of bringing about its own existence from non-existence.”[][]

            It doesn’t, of course. Nothing comes from nothing, nothing ever could.

            The universe, to be sure, never did not exist.

      • Your second example, Rabbi Morris, comes to this:

        1. Nature is complicated.
        2. Nobody understands all those complications.
        3. Therefore, God Created the Universe.

      • [][]“2) The laws and properties of the natural world seem incapable of creating such sophisticated, complicated and integrated design.”[][]

        That is a false premise, since it doesn’t seem that way at all.

        Also, notice how your are slipping “design” into your premises when it doesn’t logically belong there.

      • [][]“God is BEYOND the PHYSICAL world, INDEPENDENT OF IT.”[][]

        In other words, God is IMAGINARY, and cognitively IRRELEVANT INCOMPETENT, and IMMATERIAL.

  • I got hold of The Blind Watchmaker today. Indeed, Dawkins correctly wrote that The Origin of Species was published in 1859. Moshe Averick owes it to Professor Dawkins to at least copy a sentence accurately.

    It’s always possible to make a typographical error. But with all due respect to Moshe Averick, I don’t know how anyone can engage seriously with his ideas about evolution if he REPEATEDLY writes that the book was published 3 years earlier than it actually appeared. Would you be serious about an ‘expert’ on American history if he or she keeps referring to the Declaration of Independence from 1773? Or, the 10 original colonies?

    As to the substance, before Darwin came along Paley’s analogy seemed convincing. That’s because no one could explain how the watch just happened to work if there was no watchmaker — and no one could explain how nature just happened to work if there was no Designer.

    Darwin showed the world that nature can wholly and adequately be explained by natural selection and descent with modification. Don’t ask me beyond this for the details. I am not an evolutionary biologist but rather I’m a rabbi. In a congregation. Don’t know much about biology. Don’t know why there’s something rather than nothing — but not sure that anyone can answer that conundrum.

    However, I do claim to try to follow the truth wherever it leads, as Maimonides said. So I’m with Darwin. And Dawkins. And I know that the seminal book dates from 1859.

    Steve Listfield, Long Island NY.
    You’re welcome to my synagogue if you’re Jewish, and welcome if you’re not Jewish. We’re all related more than we think!

    • Chaim,

      My honest mistake. I will be sure to write the date correctly from now on. However, it is certainly a mistake in a detail that has no significance in terms of my basic thesis.

      You, on the other hand, have erred in your fundamental understanding of what I was saying. If you read the article carefully you will see that the point I was making was that Darwinian evolution is completely irrelevant to the entire question of the existence of a supernatural creator of life. The truth or falsehood of Darwinian theory has absolutely no bearing on the question. I wrote explicitly that I am fully prepared – for argument’s sake – to concede the truth of Darwinian theory. This truth of my aforementioned assertion has been confirmed by Dr. Thomas Nagel (as I wrote in the article), by Dr. Frank Sonleitner of the NCSE (on their website), and Nobel Prize winner Dr. George Wald, and Nobel Prize winner, Dr. Christian DeDuve. In fact it does not have to be confirmed by anyone, it is self-apparent to all who are clear thinking individuals. The baffling mystery of Origin of Life was the reason why Antony Flew abandoned atheism. It also transformed the late Sir Fred Hoyle’s view of reality. Unless you have some coherent response to what I wrote, I think it’s time you reconsidered your position also.

      I appreciate all comments, especially since you have pointed out a mistake that I have made. However, the fact that you have spent so much time focusing on that minor factual error (in both of your posts), and allowed that to blind you to the major thrust of the article, should raise some questions in your own mind.

      • []“My honest mistake. I will be sure to write the date correctly from now on.”[]

        I don’t believe such a typo rises to the level of “honest mistake.” It is too trivial to even pay attention to in this kind of forum. (Chaim seems to be off in his own little world, without much to say. Even less than Rex, if you can believe it.)

        • Update:

          I guess I should have resisted the temptation to add that final sentence. Oh well, I didn’t manage to resist — but at least I wasn’t far off the mark.

    • [][]“As to the substance, before Darwin came along Paley’s analogy seemed convincing. That’s because no one could explain how the watch just happened to work if there was no watchmaker — and no one could explain how nature just happened to work if there was no Designer.”[][]

      This fallacy that “before Darwin,” theism somehow made sense needs to be dropped.

      Theism has never made sense, from the beginning. Granted that theism was more understandable in more primitive times, but it never ever made any sense (or had any real plausibility).

      Darwin didn’t make the world safe for atheism, he just piled on some more facts showing further how ridiculous the “Creation, by God!” story is.

    • After Richard Dawkins ridiculed theists for their ignorance of the scriptures, he was asked by his debate opponent what the subtitle is of Darwin’s On The Origin of Species. Poor Dick was at a loss for words. I’ll bet he knows it now.

      • I don’t think Darwin had “The Chosen People” in mind. Darwin was writing about natural selection, not the murdering of unbelievers in the tradition of the Bible.

    • To Chaim (aka Steve Listfeld),

      You wrote:

      “Darwin showed the world that nature can wholly and adequately be explained by natural selection and descent with modification.”

      I would argue that this is not the case. Darwin ARGUED that the development of biological species (NOT all of nature, just one aspect of nature) can be wholly and adequately explained by the joint mechanism of random variation and natural selection.

      Furthermore, he never discussed (except for one passing comment) the origin of the first cell (which is what Rabbi Averick is focusing on). As such, even if Darwin’s explanation is true, it cannot ‘wholly’ explain the development of biological life because it cannot explain the origin of the cell upon which the entire mechanism depends.

      Another reason why it can’t wholly explain the development of biological life is because it has nothing to say on the creation and development of the natural environment in which natural selection plays a role.

      As most, what can be said, is that given the first cell and given the right natural environment, random variations plus natural selection can explain the development of biological life.

      But, there is more to the story. Arguing for a mechanism and demonstrating that mechanism is not the same thing. And, indeed, Dawkin’s book The Blind Watchmaker is a great example of that fact.

      Dawkins set’s out to show how the random mutations (the modern version of Darwin’s theory) plus natural selection can create biologically functional organisms in an UNIDRECTED, UNGUIDED processes. He does this with two examples.

      The first (Me Thinks It Is a Weasel) leads to a functional end – the statement Me Thinks It Is a Weasel, but uses a DIRECTED process.

      The second (the stick figures), leads to an end which is NOT functional (two dimensional, loosely similar ARTISTIC REPRESENTATIONS of functional items).

      Dawkins seems to think that you can combine the two together – I’ll take the UNDIRECTED process that did NOT lead to a functional end and combine it with the FUNCTIONAL process that did lead to a functional end.

      Science and logic, unfortunately for Dawkins, do not work that way. If you want to demonstrate that evolution a) can do the job and b) does it in an UNDIRECTED process, then you need evidence that a) that is possible and b) that it actually happened.

      Right now the theory of evolution seems stuck at a) – i.e., demonstrating that it is even possible. I have more on this issue on my site – particularly, this article: http://morethinking.com/2011/antibiotic-resistance-and-evolution-understanding-what-really-happens/

      I respect and understand that you are not a scientist – not everyone can be a scientist and even for lay-people there is a lot to learn to understand the philosophical conversations that take place concerning science.

      With that said, it is important to realize that scientists need to demonstrate their theories, not just argue and its important to discern when a theory has been rigorously demonstrated as opposed to argued for.

      Secondly, it’s important to understand that scientists are not philosophers, and their ability to draw philosophical conclusions from scientific theories may not be their strong suit. I would argue that this is the case with Dawkins. He is smart and clever, but often times he is better at writing and rhetoric than he is at philosophy or theology.

    • Chaim: You say that Darwin “showed the world that nature can wholly and adequately be explained by natural selection and descent with modification”, but what Darwin really showed was rather that certain traits are selected for that give a reproductive advantage. We pretty much all agree on that. Were the appearances of these traits the result of random mutations? Or did the coding for them already exist in the organism’s genome, but went unexpressed until it became a survival advantage to the organism. The idea of a biological journey from simple single celled organisms to sentient man, made possible by undirected goal-less mutations acted upon by natural selection, cannot explain the degrees of difference of the human intellect from those we purportedly derived from in the common descent scenario.

  • [][][]
    Moshe Morris
    July 19, 2012
    4:36 pm

    “But the natural world that we look at suggests that such an [unnatural/supernatural/Godly] entity not only can exist, but is necessary for the existence of the natural world that we observe.
    [][][]

    Nothing in the real world actually suggests, indicates, or is evidence for anything other than nature itself.

    The notion that “nature suggests the supernatural” is pure religious doctrine, inspired by nothing but blind faith. There is no logical way to get from nature to the supernatural. The road to religion is strictly blind faith — in defiance of reason and logic, i.e., of real world experience.

  • Theistic Creationists have claimed that the odds are “near-zero” that life could exist naturally — so they prefer to believe, oddly enough, in the supernatural — the odds of which are absolutely zero (not merely “near-zero”).

    I’m also curious as to what odds they can cite against the possibility of water existing naturally in the universe.

  • Theistic Creationists have claimed that the odds are “near-zero” that life could exist naturally — so they prefer to belief, oddly enough, in the supernatural — the odds of which are absolutely zero (not merely “near-zero”).

    I’m also curious as to what odds they can cite against the possibility of water existing naturally in the universe.

    • Update:

      Rex, if you have been paying attention, you may have noticed I’ve been making some spelling errors (“watched” for “watches,” and “belief” for “believe”). I am curious whether you might interpret that as punishment from God for not agreeing with you, and not believing in the Averick “IDOL“?

      Seems farfetched, I admit, but then your notion of “understanding biochem” is rather farfetched, so who knows.

    • Steve, I’m not so shallow as to call you out on spelling errors. I make them myself from time to time. In fact, I tend to skip over most of your comments so I didn’t even notice the errors…sorry. I happened to notice the above comment because it had my name in it.

      As for punishment from G-d, I really couldn’t say. If I were G-d, I’d let you wallow in your own ignorance for abusing the gift of intelligence that I’d given you. Come to think of it…

      • Okay, good, Rex. Ignoring non-theists is your best bet. You can’t go wrong with that, regardless of your level of understanding of chemistry and biology.

        You should try to convince Rabbi Averick of the wisdom of such ignorance.

        It’s just like hitting the “mute” button when someone dares to disagree with or criticize the “Great Leader.”

      • Of course, maybe you are God, Rex. How would anybody ever know?

  • [][][]
    Moshe Morris
    July 19, 2012
    4:42 pm

    “In short, the idea that the natural world requires a creator independent of that world is both reasonable, inherently logical and is strongly suggested by the nature of the world that we observe.”[][][]

    On the contrary, it is not reasonable. It is not logical. It is not in the least bit suggested by anything actually observable out there in the world.

    The notion of a “Supernatural Creator of the World” is pure fantasy. There is nothing reasonably logical about it — and the amount of evidence of any kind you have for it is: zip.

    • Update:

      While some people prefer to believe in invisible, unnatural Gods, others prefer to believe in invisible, unnatural dimensions. How many believe in both?

      Either way, the notion that actual reality is mysteriously not adequate to the task of being actual reality is very strange.

  • [][][]“Watches depend on watchmakers because of the properties that we find in watches (namely, they need the right types of materials in the right shape and the right size configured and integrated in the right way).”[][][]

    Not exactly.

    Watched depend on watchmakers because watches are man-made.

    There is nothing unique to man-made stuff where it can only function with “the right types of materials.” Ice, for instance, wouldn’t float if it were made of lead instead of water.

    It is an equivocation to claim that having a functional shape necessitates dependence upon a “creator.”

    Watches depend on intelligent makers. Natural stuff, like ice and DNA, is quite independent of needing any intelligent maker.

    [][][]“The natural world as a whole and biological creatures in particular exhibit these same features (as well as other features which suggest that they were created).”[][][]

    No, there is no logical way to get from natural objects to any rational, non-fictional “suggestion that they were intelligently designed and created.”

    The Averick “IDOL” is only another bit of fantasy fiction.

  • I cannot believe that Richard Dawkins wrote that The Origin of Species was published in 1856.
    Yet Rabbi Averick quotes Dawkins as writing in The Blind Watchmaker: ” I said I could not imagine being an atheist before 1856 when Darwin’s Origin of Species was published.”

    Rabbi Averick twice gives that date, from his own say-so, as the year of publication. So I find three references to The Origin of Species as appearing in 1856.

    However, The Origin of Species was published in 1859. Such a basic error should not be made. And, again, I doubt that Dawkins made the error.

    Also, I don’t see how Rev. Paley’s analogy is “evidence” of a Creator. It’s an interesting analogy — but it seems to me that analogies can never be “evidence.” In fact, I don’t believe that Paley ever gave evidence of a Creator.

    • Even if it was published last year, or 300 years ago, Darwin’s On the Origin book is not an argument either for or against atheism.

      Theism is purely a matter of blind faith. It in no way depends on the state of human knowledge at any time.

    • Hello Chaim,

      Paley’s argument is NOT an argument from analogy. Hume’s character (forgot the name) in Dialogues for Natural Religion used an argument from analogy which Hume strongly attacked.

      Paley’s argument is not based on comparing the natural world to a watch, but rather noting which FEATURES in a watch lead me to conclude that it is designed and then noting that we find the same features in the natural world.

      The argument is not about whether or not the natural world or aspects of it are like machines, but whether or not certain types of features can come about without some sort of intelligent creator.

      I discuss this more at the end of this article: http://morethinking.com/2011/introduction-to-the-argument-from-design/

      • [][]“The argument is … whether or not certain types of features can come about without some sort of intelligent creator.”[][]

        There are legitimate questions of who created what, not to mention when and how, IF you stick to what’s happening in the real world.

        But when you try to step outside nature, when you look for something supernatural, then you have switched from knowledge-seeking to working with figments of the imagination.

        Natural processes are reality. “Creation, by God!” is fantasy fiction.

        • You seem to think that the idea of an entity outside of space and time is inherently ridiculous. But the natural world that we look at suggests that such an entity not only can exist, but is necessary for the existence of the natural world that we observe.

          We agree that natural processes are real – but they also seem insufficient to bring about their own existence.

          • [][]“You seem to think that the idea of an entity outside of space and time is inherently ridiculous.”[][]

            Ridiculous? Perhaps.

            But certainly illogical, due to being physically impossible.

            [][]“But the natural world that we look at suggests that such an [unnatural/supernatural] entity not only can exist, but is necessary for the existence of the natural world that we observe.”[][]

            Such a suggestion is not a rational one, but simply an expression of religious fantasizing.

            Logically following the actual evidence leads nowhere near such a fantastic “suggestion.”

            [][]“We agree that natural processes are real – but they also seem insufficient to bring about their own existence.”[][]

            Well, naturally they are. Not only can something not create itself, something can never come from nothing. But why in the world should that mean that nature is necessarily dependent on something unnatural/supernatural?

            There is no sound reason to bring in the Supernatural at all (especially since it is only imaginary).

          • [][]“You seem to think that the idea of an entity outside of space and time is inherently ridiculous.”[][]

            Ridiculous? Perhaps.

            But certainly illogical, due to being physically impossible.

            [][]“But the natural world that we look at suggests that such an [unnatural/supernatural] entity not only can exist, but is necessary for the existence of the natural world that we observe.”[][]

            Such a suggestion is not a rational one, but simply an expression of religious fantasizing.

            Logically following the actual evidence leads nowhere near such a fantastic “suggestion.”

            [][]“We agree that natural processes are real – but they also seem insufficient to bring about their own existence.”[][]

            Well, naturally they are. Not only can something not create itself, something can never come from nothing. But why in the world should that mean that nature is necessarily dependent on something unnatural/supernatural?

            There is no sound reason to bring in the Supernatural at all (especially since it is only imaginary).

  • {}{}“No functional proteins – no life.”{}{}

    No water – no life.

    And, quite naturally, there is life.

    • No gravity – no life

      No Moon – no life

      No magnetosphere – no life

      No (countless amount of naturally occurring events and elements) – no life

      And yet here life is and I have yet to read any theist creation account that mentions all the factors needed to have life.

      Weird how omnipotent gods need to set up such a Rube Goldberg chain of events to create life yet claim to have done it with a snap of their fingers.

      • I don’t see how your conclusion flows from the points you made. Life is difficult to come by, it requires quite a bit – and each of those bits seemingly have to be organized, set, and structured just right for them to work properly.

        When you find a sophisticated system that has necessary components which need to be properly constructed, organized and integrated that inherently indicates that some sort of intelligent entity was need to construct, organize and integrate those components.

        In terms of ‘claiming to have done it with a snap of their fingers’. No such claim is made in the Torah. The Torah talks about a progressive creation process.

        What has been claimed is that G-d created a brilliant, sophisticated and marvelous creation (for instance, the line – ‘how wondrous are your creations’ or the ancient translation of In the Beginning as ‘With wisdom G-d created the heavens and the earth — see also Proverbs Chapter 8).

        • When you have to believe in a physical impossibility, e.g., non-living intelligence, then whatever argument your are trying to make based on that belief is logically incorrect.

          Neither watches nor watchmakers are supernatural. Watches depend on watchmakers. Nature does not depend on the supernatural. Nothing does.

          • Who says that G-d is an impossibility? There is nothing illogical or impossible about the idea of a creator.

            Watches depend on watchmakers because of the properties that we find in watches (namely, they need the right types of materials in the right shape and the right size configured and integrated in the right way).

            The natural world as a whole and biological creatures in particular exhibit these same features (as well as other features which suggest that they were created).

            That logically implies that the natural world needed a Creator.

            Now, you keep using the word supernatural. I think meta-natural, or meta-physical is a better phrase. Meta meaning beyond.

            In short, the idea that the natural world requires a creator independent of that world is both reasonable, inherently logical and is strongly suggested by the nature of the world that we observe.

          • [][]“There is nothing illogical or impossible about the idea of a creator.”[][]

            Unless you are talking about a supernatural creator — then you’ve got literally nothing.

          • How neat is it, Morris, that you sound so much like Obama — telling Nature: “If you’ve got life, you didn’t do that, Somebody Else made that happen!”

        • >Life is difficult to come by,

          Is it? Our planet alone is lousy with the stuff from acidic volcano vents at the bottom of the ocean to fluffy clouds life is all over the place. It may be so for other planets in the vast universe.

          See Mushe? You make a sweeping statement based on a limited amount of knowledge because it suits your agenda. The reality is we have no idea if life is difficult to come by, on Earth it certainly isn’t.

          > seemingly have to be organized, set, and structured just right for them to work properly.

          Seemingly organized, that’s the key word, seems as in that’s what it looks like but may not necessarily be so.

          >When you find a sophisticated system that has necessary components which need to be properly constructed, organized and integrated that inherently indicates that some sort of intelligent entity was need to construct, organize and integrate those components.

          Nope. Clocks on beaches show signs of intelligent design from the machined edges of the parts to the manufacturers signature and copyright notice on the inside. The universe has no such indication, the fact that it’s complex is immaterial because that complexity can happen over time as evolution plainly shows.

          What we have is a swirling universe of energy, matter and time and apparently those components come together in spectacular ways. No god required, certainly not a silly one like yours.

          >In terms of ‘claiming to have done it with a snap of their fingers’. No such claim is made in the Torah. The Torah talks about a progressive creation process.

          Weird, my Torah or at least the one I was taught as a pitsele had the 6 day creation with your god resting on the 7th which is why you kill someone for working on a Saturday. 6 Days to a complete cosmos seem pretty snappy to me and a far cry from the current proven estimate of 14.5 billion years give or take a million.

          >What has been claimed is that G-d created a brilliant, sophisticated and marvelous creation

          Part of the conceit of theism is that this all wise omnipotent being’s best work is you! Such a wonderful arrogance and probably why the theory of evolution makes you throw such fits. Doesn’t make you quite as special to have come up from electrified slime huh?

          As for sophisticated? Meh, pass a kidney stone, have a child born with its brains on the outside or experience one of the countless horrors that biology can inflict and then give that statement some thought. Life it pretty amazing but it’s clear that evolution operates like Microsoft with “good enough” solutions to all the problems.

          Not to mention the fact that 99% of the species on this planet have gone extinct, including some humanoid versions. What were they? Your god’s rough drafts?

          >With wisdom G-d created the heavens and the earth

          With wisdom teeth I think it should read, you know those nasty chunks of enamel that will bust your jaw open unless medical science steps in? And if only that were the only flaw but there are literally books full of solutions to your alleged god’s sloppy design ethic and efforts.

          Sorry Mushe but once again your argument of “My god is real because life!” holds as much water as a desert stranded Wiffle-ball.

          • >Life is difficult to come by,

            Is it? Our planet alone is lousy with the stuff from acidic volcano vents at the bottom of the ocean to fluffy clouds life is all over the place. It may be so for other planets in the vast universe.

            Actually, life is particularly difficult to come by – and there are a number of properties and features that need to be just right for life to exist on planet earth. The fact that the earth teems with life does not indicate that life is easy or hard to come by. What does determine it is understanding what life is, how it operates and what is needed for it to exist and develop. When you understand that you realize that if the universe, the laws of physics, the planet earth, and the cell weren’t created just right then life as know it would be impossible.

            See Mushe? You make a sweeping statement based on a limited amount of knowledge because it suits your agenda. The reality is we have no idea if life is difficult to come by, on Earth it certainly isn’t.

            First of all, I would like to point out that I am NOT Rabbi Maverick. My first name is also Moshe, but I’m a different Moshe.

            Secondly, my statement is based on what I know about the Big Bang, the nature of the atom, the properties of the laws of physics, the cell, DNA and more. I’m not an expert in these areas, but I am taking the time to learn as much as I can about all of this and more. Based on that research and studying what scientists in the field have to say, I can say that we do have an idea if life is difficult to come by and the answer is an overwhelming yes – and that includes on earth. See, for example, Rare Earth or The Privilidged Planet for more on the topic.

            > seemingly have to be organized, set, and structured just right for them to work properly.

            Seemingly organized, that’s the key word, seems as in that’s what it looks like but may not necessarily be so.

            Don’t read too much into the word seemingly. Take the time to learn cell biology, for instance, and you’ll realize that there is no need for the word seemingly at all. From all that we know, it NECESSARILY has to be well organized and structured.

            >When you find a sophisticated system that has necessary components which need to be properly constructed, organized and integrated that inherently indicates that some sort of intelligent entity was need to construct, organize and integrate those components.

            Nope. Clocks on beaches show signs of intelligent design from the machined edges of the parts to the manufacturers signature and copyright notice on the inside. The universe has no such indication, the fact that it’s complex is immaterial because that complexity can happen over time as evolution plainly shows.

            Clocks show signs of intelligent design because they require the right materials of the right size and right shape configured and integrated in the right order. The universe shows signs of design because it exhibits all of those features, except in a far more sophisticated manner – plus many other elements that make it look designed (or a ‘put up job’ as Fred Hoyle put it).
            In terms of complexity over time – it is claimed that evolution shows that, but in science the proof is in the pudding and the proof for the random mutations/natural selection mechanism is terribly lacking (as the ID community consistently points out and as others like Professor James A. Shapiro of the University of Chicago also point out).

            And even if you want to hold by the random mutation/natural selection mechanism – that mechanism is depenendent upon a whole other host of factors being just right fot it to be able to do the job. In short, there is no such things as a free lunch – you don’t just get complexity because it ‘evolved’ that way. You need a means of bringing about that complexity.

            What’s more, the universe looks designed not just because it’s complex, but because it is built on mathematical laws and finely-tuned properties that all seem to be ‘just right’.

            What we have is a swirling universe of energy, matter and time and apparently those components come together in spectacular ways. No god required, certainly not a silly one like yours.

            Please tell me, how did the original energy of the universe form into matter? Where did the mathematical laws of physics come from? How did the properties of those laws get set just right? How did that matter form into atoms? How did those atoms for into elements like Carbon? How did molecules form into DNA and the cell? How did the cell form into multicellular creatures (with cellular communication and complex organs)? Making the statement ‘no god required’ does not make that statement true, logical or meaningful.

            The simple fact of the matter is that each and every step of the way looks designed. Every step looks like it is integrated into a greater whole. And the greater whole looks like it is geared towards creating conscious creatures like us (who are able to gain some sort of understanding of that greater whole which produced it).

            You can imagine that the universe can create itself and you can hold out hope for some grand scientific explanation of how that is possible, but nothing in our knowledge today indicates that such a thing is possible or will ever be discovered.

            >In terms of ‘claiming to have done it with a snap of their fingers’. No such claim is made in the Torah. The Torah talks about a progressive creation process.

            Weird, my Torah or at least the one I was taught as a pitsele had the 6 day creation with your god resting on the 7th which is why you kill someone for working on a Saturday. 6 Days to a complete cosmos seem pretty snappy to me and a far cry from the current proven estimate of 14.5 billion years give or take a million.

            G-d first creates the heavens and the earth (which, according to the Ramban and others means that he created the potential for the heavens and the earth, not the actual heavens and the earth). Second, G-d creates light. Third, G-d creates the ‘firmament’ (we’ll leave off for now what that is – my sense is that it is the atmosphere and that the Torah is narrowing its focus from the universe as a whole to the earth in particular). Then G-d creates plant life (or, as some commentators say, the beginnings or potential for plant life). Then G-d creates or places in the sky or makes visible the sun, moon and stars. Then G-d creates the sea animals followed by flying animals. Then G-d creates land animals. Then G-d creates man.

            What’s more, the word ‘creates’ is not 100% accurate in terms of what the Torah says. G-d did create the heavens and the earth (or the raw material out of which they were built – again, see Ramban). But he had the earth bring forth vegetation. He had the waters bring forth the first life and then the earth bring forth animal life from that life. If you look into the nuances of the story, you’ll see a more sophisticated explanation of what the creation process was then you described or remembered.

            In terms of the age of the universe. Read Gerald Schroeder’s The Science of G-d. Just make sure that you have some basic understanding of Einstein’s Theory of Relativity before you read it. Furthermore, the age of the universe isn’t proven, it’s argued for based on a number of assumptions. Different methods are used which roughly work together, and it’s a reasonable argument which works well in the general contemporary scientific view of the world, but proved is too strong a word.

            >What has been claimed is that G-d created a brilliant, sophisticated and marvelous creation

            Part of the conceit of theism is that this all wise omnipotent being’s best work is you! Such a wonderful arrogance and probably why the theory of evolution makes you throw such fits. Doesn’t make you quite as special to have come up from electrified slime huh?

            I think you are putting words into my and other peoples mouth. I think I said that the creation as a whole is brilliant, sophisticated and marvelous.

            With that said, I do think that anyone who has taken the time to study the matter would agree that the human being is a wonder to behold. 75 – 100 TRILLION cells working in conjunction together, the human eye, the human brain, the cabaliity to speak and communicate, the opposable thumb — all combine together to create a most remarkable creature who is definitely unique on this planet of ours. If you have a problem with that, sobeit – but that is a different conversation. For now, let’s stay focused on the issue of whether or not the universe looks designed and, if so, what that means.

            In terms of the theory of evolution – doesn’t throw me into fits. My only question is if it is true and, if it is true, by which mechanism it works. From what I’ve gathered so far, it can at best be looked upon similar to Copernicus’s theory before Kepler and Newton – a new way of looking at the world, but lacks the rigorous proof that science requires. That doesn’t mean that one can’t make any argument in favor of it, but I don’t consider it nearly as well established as other areas of science. If they could provide me the types of proof that I find convincing in other areas of science I would be happy to take the theory more seriously.

            As for sophisticated? Meh, pass a kidney stone, have a child born with its brains on the outside or experience one of the countless horrors that biology can inflict and then give that statement some thought. Life it pretty amazing but it’s clear that evolution operates like Microsoft with “good enough” solutions to all the problems.

            Pain, death, and disease do not negate the sophistication or brilliance of the design that we see. I wouldn’t argue that my computer is not well designed just because it can get a computer virus or break down. The two have nothing to do with each other – one detects design by looking at how something is put together, not by whether or not it can break down after it is put together.

            Furthermore, some diseases look as brilliantly designed as anything else we find in nature (some viruses look pretty sophisticated). Now, we might wonder why such features exist in the world, but that doesn’t change the fact that they look designed and that as such imply a designer. It’s also pretty clear that the ‘good enough’ solutions doesn’t hold up to examination. The universe doesn’t look ‘good enough’, it looks amazingly designed.

            Let’s use the eye as an example. How many people get torned retinas? Seemingly 5 out of every 100,000 people (with the rate increasing as people get older). Not bad for quality control. And let’s note that people are using their eyes each and every day, hour after hour, year after year in a wide variety of settings, environments and circumstances. Not bad for quality control.

            And how about that blind spot. A real problem – if you have one eye closed and are looking at a pin on top of a pencil at a distance of a foot or two away at a 15 degree angle. And let’s not forget that it may be that the blind spot is actually an optimum solution (more on that another time).

            Not to mention the fact that 99% of the species on this planet have gone extinct, including some humanoid versions. What were they? Your god’s rough drafts?

            Let’s see, so if 1% went extinct there is a G-d, if 99% went extinct there is not a G-d? What is 50%? A junior G-d? What exactly in the Torah makes you think that G-d wouldn’t have 99% of species go extinct? The Flood? The Midrash which states that G-d created and destroyed worlds before creating ours? The plagues or punishments that G-d brings?

            You seem to think that if we lived in a Brady Bunch type world then we can believe in G-d, otherwise no dice. Why not? You seem to need to fit the concept of G-d into your preconceived notions of Who G-d would be and how G-d would act. The Torah’s perspective is the opposite. Our job is to try and understand, to the best of our ability, Who G-d is, What G-d wants and how WE are suppose to act.

            In short, we don’t fit G-d into our philosophical constructs.

            >With wisdom G-d created the heavens and the earth

            With wisdom teeth I think it should read, you know those nasty chunks of enamel that will bust your jaw open unless medical science steps in? And if only that were the only flaw but there are literally books full of solutions to your alleged god’s sloppy design ethic and efforts.

            Let me ask you a simple question – what does it take to create a wisdom tooth? And what does it take to create the intellect that can lead to the understandings that medical science has achieved? You don’t like the negative consequences of a wisdom tooth. Fine. That has NOTHING TO DO WITH WHETHER OR NOT THEY WERE DESIGNED!

            Take the time to study wisdom teeth. Learn everything there is to know about them and then see whether or not they looked designed. I haven’t studied wisdom teeth, but I bet you that if I did I’d find wonders upon wonders of design and sophistication in them (just like in most everything else we study in the natural world).

            Your argument seems to be – if it is unpleasant for me, hurts me or damages me then it couldn’t have been designed. How about guns? Missiles? Bombs? Fighter planes? Chemical weapons? Those are pretty destructive? Can do a lot more damage than a wisdom tooth. I guess that means they weren’t designed?

            Hardly. Design is determined by the principles relating to design – not by utility or whether or not they have negative consequences.

        • [][]{}“When you find a sophisticated system that has necessary components which need to be properly constructed, organized and integrated that inherently indicates that some sort of intelligent entity was need to construct, organize and integrate those components.”{}[][]

          Unless, of course, it is something known to predate the evolution of intelligence. DNA, for example, cannot possibly be the product of any “sort of intelligent entity.”

    • Gravity – physical law
      Moon – physical law
      Magnetosphere – physical law

      Partial nucleotide sequence of insulin –
      CCATAGCACGTTACAACGTGAAGGTAA

      NO physical law
      NO chance
      NO law/chance combination

      just purposeful, specified, complex information. What’s so hard to flippin’ understand? And you guys say we’re devoid of reason. Your vehement insistence that DNA is not CSI is proof that you know the consequences of admitting that it is. It must be lonely being in such a state of denial.

      • [][]“… just purposeful, specified, complex information.”[][]

        In your dreams.

        But you are far from alone in your state of fantasy.

      • CCATAGCACGTTACAACGTGAAGGTAA
        Um… you do know that those are arbitrary characters that our culture has assigned to describe the chemicals that make up DNA right? That if you were to open up the double helix you wouldn’t see anything like those letters or anything letter like at all. Just chemicals beholden to physics doing the only think they can do.

        That combination of atoms behave like insulin because that combination of atoms cannot do anything but. It’s not a code in the way you are insisting, it’s a chain reaction that is completely indifferent to the way we describe it.

      • Golly, salvage, I sure didn’t know that. I thought G-d painted the letters on each molecule. I’m so glad you pointed that out. You’re really, really smart. In fact, I’M AN ATHEIST NOW!!!!!! NOT

        Um…you do know that the 3-nucleotide combinations (as represented by the letters) are logically grouped into codons that correspond to one of the 20 amino acids that are the constituents of proteins. There are even start and stop codons to signal to the polymerase where to begin and end RNA transcription. Design, Design, Design. Not the illusion of…but design. Intelligent design. Creation. No laws, no chance, just wonderful design.

        I don’t know if denial is true in your case. It is for Stoddard but either way you’re not helping your side, dude.

        • [][]“… Design, Design, Design…. Intelligent design. Creation. No laws, no chance, just wonderful design.”[][]

          The religious denial of reality — substituting a fictional God for natural processes — is still a cognitive dead end. By design, of course, by the theistic apologists. For them, supernatural design fantasies trump reality.

        • Well, you keep repeating “Design” over and over again, perhaps that will make it so.

          Meanwhile in reality amino acids do their thing because that’s what amino acids do in that context. Nothing “informs” or otherwise directs them save physics.

          If only your god had mentioned DNA when it was bragging about making people from dirt and Eve from a rib.

  • Micha Liberman

    This is the classic argument that religious people have been making for Milena. If I don’t understand something, it must be god. Before Copernicus, we did not understand the rising and setting of the sun so it was proof of god. Then we we figured it out so religion moved the goalposts (orthodox Jews still praise god everyday for hanging the stars at night.) We see this pattern over and over.
    Before Darwin we did not understand evolution, so the complexity of living organisms was proof of god. Then Darwin showed how that is a natural process, so they move the goalposts again. Now we don’t understand biogenesis so that must be proof of god. Once we figure that out they will move the goalpost again. Sorry people, the god myth was very useful for a while but we are past it. We need to make moral decisions based on a solid understanding of the likely outcome of those decisions, and maintain the nimbleness (a characteristic that is completely anathema to a belief in any kind of absolute truth) to change our morality as we learn more about how the world works, and more about the outcomes, intended and unintended, of those moral choices.

    • Hello Micha,

      What you are describing is commonly known as a G-d of the Gaps argument. It’s true that there is a history of such arguments being made (including by such notable minds as Newton himself).

      But that does not mean that every single argument made for G-d from the natural world is a G-d of the Gaps argument.

      There is a difference between making an argument from what we don’t know versus what we do know. I don’t know how the planets move, it must be G-d is a G-d of the Gaps argument.

      I do understand the nature of DNA and the nature of codes and their nature suggests an intelligent Creator is NOT a G-d of the Gaps argument, it’s an argument from knowledge [see this article for more on this point: http://morethinking.com/2011/getting-a-better-understanding-of-the-g-d-of-the-gaps/.

      In terms of praising G-d for hanging the stars each night - gravity seems like a pretty amazing 'hanger' to me. Particular when you consider that it needs to be properly tuned in order for stars to form.

      In terms of Darwin showing that it's a natural process...

      For one, a natural process does not necessarily take G-d out of the picture as one needs to still understand how that natural process came to be in the first place. You might consider this 'moving the goal post', but if that process in and of itself demands an ultimate explanation and (more particularly) the explanation seems to require some sort of intelligent, capable entity - then you are back to evidence for a Creator again.

      Secondly, Darwin didn't show that it's a natural process - he argued for a natural process. The scientific community has since been attempting to demonstrate that his argument was correct with limited success and some significant problems posed by aspects of the fossil record and modern cell biology [which is why professors like James A. Shapiro are proposing new mechanisms]. It’s important to distinguish between what science has actually accomplished and what accomplished speakers (like Dawkins) claim.

      • [][]“a natural process does not necessarily take G-d out of the picture as one needs to still understand how that natural process came to be in the first place.”[][]

        The specific meaning of that premise, Morris, is that you want to use fiction to explain fact.

        Moving your goal posts outside of reality is a cognitive dead end.

    • Micha, is the idea that there is no absolute truth an absolute truth? Yes or no?

  • The Task of Theism (and belief in the “IDOL“)

    [][]
    moshe averick
    July 18, 2012
    2:25 pm

    “In other words convince yourself that your fantasy version of meaning actually has real significance.”
    [][]

    That’s the daunting task religious believers have set for themselves.

    It is not practical to take moral guidance from an unnatural source — especially since you only have other people telling you about what God wants you to do (given that He never shows up to take personal responsibility for His Commandments).

  • I’m getting a little tired of reading how atheism thinks it has cornered the market on reason. Practically everything they’re involved in has Reason in the name. It’s as if they’re trying to convince themselves of something that just ain’t so. Imagine if someone went around telling everyone he met how smart he was. Eventually people will start to realize that he is in fact not that smart and probably a complete buffoon. So it is with atheism.

    The facts for G-d’s existence are there for those who will follow the evidence. Why doesn’t G-d just show undeniable evidence for his existence that would remove all doubt once and for all for everybody?

    Blaise Pascal said it best:
    “In faith there is enough light for those who want to believe and enough shadows to blind those who don’t.”

    Makes sense. Not even G-d wants to spend eternity with someone who can’t stand him?

    • [][]“The facts for God’s existence are there for those who will follow the evidence.”[][]

      Precisely zero facts, leading nowhere. Got it.

      • I suggest you go watch some William Lane Craig debates, or listen to some of his podcasts on iTunes. He will demonstrate intellectually and powerfully the reality of God’s existence.

        http://www.reasonablefaith.org

        Craig embarrassingly demolished Sam Harris in that debate, nailed Krauss in another, dealt to Peter Atkins in another, and so the long list goes on.

        Honestly, these new atheists are pathetic, and reason is certainly not their strong point. Personally I suspect their dislike of Christianity is often rooted more in a psychology of hurt or fear of Islam and religion in general than reason.

        • [][]” He will demonstrate intellectually and powerfully the reality of God’s existence.”[][]

          It’s just a bunch of baloney, right?

          All you have to do is point out that lot’s of people believe in God. That’s as real as God gets.

          God, the fictional character, certainly is well-known and even popular.

          • Assuming you Sir are an atheist, then I have to wonder why you bother spending your life on these websites repeatedly responding to the Maverick.

            Atheists only get one chance at life, so why waste your short blip of time on here?

            Further, since according to atheism, all you (Steve Stoddard) are is a complex arrangement of chemicals that could be reduced to a few litres of water and a bag of blood and bone, why do you even have the moral fortitude to bother complaining about religious people? All of your moral complaints are ultimately just chemical reaction in your body.

            Atheism — as William Lane Craig demonstrates so well in his debates — is morally vacuous. That it NOT to say that atheists have no morality. It IS to say that they have no ontological basis for morality. So I ask you Steve — to what moral law are you appealing when you make moral calls against the Maverick or other religious believers?

            You see Steve, at rock bottom, atheism is irrational, and you, by your actions demonstrated on this website, emphasize that point so well.

            And btw, all your reply contained was cynicism and a lot of hissing. Why? What has made you like this? Is you behavior simply a reflection of bad past experiences?

          • [][]“And btw, all your reply contained was cynicism and a lot of hissing. Why?”[][]

            It was a deliberate matching to the style of your post which inspired the reply. I figured that if you could dish it out, you could take it, too.

            Just trying to make a point.

          • [][]“Atheism is morally vacuous.”[][]

            I certainly agree. I’ve said so all along.

            There is nothing to atheism other than the choice not to be a theist. There is no way to build a morality (or a “worldview”) on nothing but that.

          • Besides, Jonathan, I did point out that the closest thing you have for “evidence of God” is that lot’s of people believe in various version of God. That fictional manifestation is as close to real as God could ever get.

        • All you have to do is point out that lots of people believe in God. That’s as real as God gets.

    • Nope, doesn’t make sense.

    • [][]Blaise Pascal said, “In faith there is enough light for those who want to believe and enough shadows to blind those who don’t.”[][]

      The purpose (and practice) of religious faith is to blind the believer to reality so that he can indulge his fantasies. To be religiously faithful is to live in a fog of shadowy beliefs in things unnatural — instead of reasonably dealing with real life.

      People who refuse to indulge in religious faith at least have the advantage of not willfully blinding themselves, no matter how much they either know or don’t know.

  • The Mirage of Theism

    Some people can look at the world around them and feel that they see the Face Of God, the “IDOL”, even though there is no such thing. That’s an interesting analogy to thinking you see water where there isn’t any water.

  • The question is still on the table, Moshe, about how you can make sense out of claiming that DNA is “code-bearing” whereas hydrogen and oxygen aren’t.

    Is the idea that God would have been unable to create life if He hadn’t had pre-existing natural elements to work with?

    • It’s simple Steve – DNA uses four different chemicals to code for the proper sequence of amino acids to build functional proteins. It’s similar (although more advanced) than the binary system used in computers to store, process and transmit information.

      There are two main features of DNA that need to be noted. One is codons – this is the symbolic relationship created between a sequence of three nucleotides (the four chemicals I mentioned above) and an amino acid (or a stop or start sequence).

      There is no chemical or physical property which determines this relationship – it is similar to how red means stop and green means go. Red doesn’t inherently mean stop – it is an intellectually agreed upon system. Similarly, no three nucleotides inherently represent a particular codon (which codes for a particular amino acid) – rather it has all the ear marks of a symbolic coded relationship like we find in ASCII code, stop lights and numerous other places.

      Furthermore, there is the actual sequence of the nucleotides which determine the order of the amino acids (which determine the particular protein to be used). This is similar to the sequence of ones and zeros on a hard drive which save a document or file on a computer.

      It’s the proper sequence that creates the necessary information for the system to work – just like it is the proper sequence of ones and zeros which determines whether or not my document is saved and retrievable or not.

      Hydrogen, Oxygen and other elements, on the other hand, are not coded system. They are created by a rather incredible system known as the atom – and the particular element is determined by the number of protons in the nucleus, but while quite ingenious it is not a coded system.

      To put it all together – elements like hydrogen and oxygen (as well as carbon and nitrogen) are atoms which are used to form molecules. Molecules are then able to do a variety of functions.

      For instance, one type of molecule is an amino acid. String together the right amino acids in the right order and you have a functional protein. The wrong amino acids or the right ones in the wrong order and you don’t have a functional protein.

      No functional proteins – no life.

      Another type of molecule is a nucleotide. Nucleotides are used in a coded system to direct the sequencing of amino acids.

      So, in short – you have atoms which form molecules. And molecules which are used in more complicated systems – including (but not limited to) the coded system of DNA.

      In terms of ‘pre-existing natural elements’. All the elements that you refer to – all those atoms, are not thought to have existed at the very beginning (i.e., according to modern science).

      Atoms are organized structures consisting of elements (such as protons and electrons) and forces (such as the electromagnetic force). Originally, though, at the moment of the Big Bang, there was only energy – enough energy to briefly create the basic building blocks of atoms.

      So at the moment of the Big Bang, all there was was energy – no natural elements, not even atoms. In fact, not even the elements or atoms and not even the sub-atomic particles that make up those elements.

      • You are not making a coherent case that “code” doesn’t exist in atoms, but mysteriously shows up in cells. It simply looks like you are grasping for a rationalization for faith in the supernatural.

        There is no sense in the claim that structure in atoms doesn’t mean “code!” while structure in DNA does. You are looking at natural processes and trying to shoehorn the supernatural in there because you feel strongly that you really, really need it to be there.

        • I think the problem is that we need to understand what a code is. I attempt to explain what a code is in this article: http://morethinking.com/2012/how-easy-is-it-to-type-the-letter-a/

          I think reading it may help explain what a code is and what it isn’t.

          Structures are not codes. Codes are particular types of system. A building isn’t a code – even thought it is well organized, planned, etc. ASCII, though, is a code.

          There is a difference and I would recommend you take the time to understand the difference.

          In terms of a natural process – we all agree that DNA occurs in nature. The question is how did it get into nature.

          The problem is that based on what we know about nature and its laws, we can’t account for how nature and its laws could have produced DNA.

          In terms of trying to ‘shoehorn’ and ‘needing it to be there’. I don’t base my belief in G-d on DNA and I don’t need DNA to be a code in order for me to believe in G-d.

          It does seem, though, that you need to think that my belief is based on some sort of psychological need.

          But conversations about psychological needs are fruitless. It would be much more productive if you would take the time to understand what a code is and what is not a code and understand why people think DNA is a code. We can then talk about what that does and does not mean.

          [NOTE - for those of you who are wondering, I will deal with the question of G-d of the Gaps in another comment].

          • [][]“In terms of a natural process – we all agree that DNA occurs in nature. The question is how did it get into nature.”[][]

            There is only one reasonable answer: naturally, of course. In the real world, there is no alternative to nature.

          • [][]“Structures are not codes.”[][]

            DNA, like oxygen, etc., has structure, but not code.

        • Samuel Johnson

          It is rather sad to watch, Steve, but with every post the your deperation becomes more and more obvious.

          To say you have been intellectually out classed by Moshe Morris would be a gross understatement, though I am sure that it was not his motive for sharing his expertise.

          At this point, I actually feel sorry for you, but I hope that you can someday find peace.

      • [][]“DNA uses four different chemicals to code for the proper sequence of amino acids to build functional proteins.”[][]

        And calcium and copper, for instance, have four different electron shells. It makes just as much sense to claim that the “four different electron shells” code for a proper sequence as it does to claim that “four different chemicals” code for a proper sequence. Neither claim can be literally true.

        • Steve, you’re starting to embarass yourself – if you have any shame. If not, then you’re surely embarassing biologists who actually know a bit about biochem. Is there anybody who knows freshmen bio that will come to Steve’s defense? Good grief! Somebody save him!!!

          • Rex, you really shouldn’t make it so obvious how desperate you are getting over being on the wrong side of the argument. “Good grief!” for sure.

            You don’t have any biochemistry on your side. You have nothing but fanatical belief in the unnatural (unreal, supernatural, miraculous, etc.) You should settle down and learn to live with it.

          • Steve, your ignorance of basic biochem only reinforces my conviction that I and Rabbi Maverick on definitely on the right side of the argument and I thank you for that.

          • Well, you are quite welcome, Rex. But I’m sure your blind faith is sufficient unto the task without my help. You were misinterpreting reality long before you were misunderstanding me.

          • Just to be sure, Rex, it appears that your view is that it is prima facie evidence of a misunderstanding of “basic biochem” to think that biological process are natural.

            For you, life cannot be understood unless viewed through the fog of theism.

      • [][]“No functional proteins – no life.”[][]

        No water – no life.

        But, as it happens, we quite naturally have water, proteins, life — well, just the whole package. The real stuff — not the stuff of theistic fantasies.

        • The problem is that we don’t just ‘naturally’ have water – it actually takes something in order for water, a universe, atoms and everything else that we observe to exist and function properly.

          You see a naturally functioning system, but you don’t want to address the question of how such a system came into being or if there are any features or functions in that system which indicates that an intelligent, capable entity was needed to bring it into being.

          • [][]“The problem is that we don’t just ‘naturally’ have water – it actually takes something in order for water, a universe, atoms and everything else that we observe to exist and function properly.”[][]

            But that is what it means to “naturally have water.” Nature exists, and water is part of it — as are proteins and life.

            [][]“… you don’t want to address the question of how such a system came into being …”[][]

            But that is precisely the question we are addressing in posting on this site: Did nature, in whole or in part, have a Supernatural Creator?

            The answer is: naturally not (since the supernatural is impossible: the “something that isn’t there”).

            And note well, this is a philosophic issue, not a “psychological need” issue. I agree that your “psychological needs” are not relevant.

      • So your idea, Morris, is that God is dependent on the “Big Bang” to have given Him the material world to work with in His Creation of Life?

    • “The question is still on the table, Moshe, about how you can make sense out of claiming that DNA is “code-bearing” whereas hydrogen and oxygen aren’t.”

      Stalwart Steve, the resident repeater of redundant replies far removed from reason or reality, has trouble comprehending the difference between a bunch of atoms and complex, specified information formed by those atoms. Maybe the following picture can help. I doubt it but just maybe:

      http://tinyurl.com/yo5va2

      Just as the intelligently arranged, discrete atoms spell out the name of a company, so the discrete nucleotides spell out the specified sequence necessary to build life-permitting proteins. How unlikely is this specification? Try finding one marked atom in the entire galaxy in under 1.2 billion years. Good luck.

      • [][]“… the discrete nucleotides spell out the specified sequence necessary to build life-permitting proteins. How unlikely is this specification?”[][]

        “This specification,” as you call it, is impossible.

        You are simply imagining that there is some “specification” there because you need it to rationalize a belief in a Supernatural God to have put it there (since it clearly could not have been put there by any actual intelligent being, no of which evolved until much later).

        There is no such “specified sequence.”

        There is a sequence, most certainly, but it was not SPECIFIED in any literal sense.

      • Keep telling yourself that, Steve. You may even start to really believe it.

        • Geez, Rex, don’t be such a worrywart. I’ve already understood that for years.

          You want to believe that fantasy of a “specified sequence in DNA” because you want to believe in “Creation, by God!” It’s not rocket science.

  • Negros are the tribe of Judah. Colored folks need to wake up, and stop following Esau’s culture. The word red is Esau, in colored. There was a Black man who called who called himself red, and he woke up to call himself X. What is the X chromosome? Remember, Esau sold his birthrights, and when did African Americans get rights? Was it as being Negros our heritage, OR being called colored people, by a white red blooded nation. Esau is pride, Jacob is grace.

  • [][]‘Hydrogen and Oxygen are not “codes” that represent ideas, instructions, or information.’[][]

    Naturally not. They are not “codes” any more than DNA is.

    DNA does not “represent ideas, instructions, or information.”

    DNA is equally as natural (and “unguided”) as water.

    [][]“Nucleobases are arranged in a specific order and it is this specific order that represents the coded instructions …”[][]

    That is no more true than claiming that “electrons in atoms are arranged in a specific order and it is this specific order that represents the coded instructions …”

    Nature is not code.

    [][]“Hydrogen and Oxygen just happen to combine in a certain way.”[][]

    Correct. And that is equally true of the A-T and C-G pairing in the DNA spiral.

    It’s quite natural.

    There is absolutely nothing unnatural about it at all.

    • Samuel Johnson

      Nature is natural. Brilliant analysis.

      However, asserting that DNA is not information does not negate the fact that is. If it is ot information, then what is it? A code? Programming language, perhaps?

      Rather than acknowledge the implications of the origin of information you seem to be saying we should simply be satisfied in the knowledge that it is there.

      You can believe what ever you want to. As an atheist, that is your God given right, but be aware that such assertions represent at least as much, if not much more of a leap of faith than a belief in God.

      Honestly, you don’t even come close to making a sensible defense of your case that God does not exist.
      Ridicule is not an argument.

      This is purely a philosophical question, and attempts to hide behind circular logic and pretentious claims of scientific authority lend less, not more, credibility to your world view.

      • [][]“you don’t even come close to making a sensible defense of your case that God does not exist.”[][]

        It is not logically possible to make a sensible scientific “case that God does not exist,” since there is nothing there to make a case about one way or the other.

        God is a figment of the imagination — not something real and therefore capable of having a case made about it.

        There are many different stories about God, different versions of stories about God, even different versions of God. Nonetheless, it is all fiction. That’s just the way it is.

      • [][]“However, asserting that DNA is not information does not negate the fact that is.”[][]

        The fact is that DNA is not information, and there’s nothing we can do about it. We observe nature, we don’t vote on it (or dictate to it).

        Anthropomorphizing DNA can be fun, but it doesn’t change reality.

      • ][]["Nature is natural. Brilliant analysis."][][

        It is. We need to face the fact.

      • By the way, Samuel, since Tugwell was citing you a while back, maybe you could return the favor.

      • Edward Peltzer

        Samuel:

        Do not waste your time debating Steve Stoddard; that would be like “casting pearls before swine.”

        He has drunk the atheist kool-aid and bought into all their lies. He does not know reason, his knowledge of the physical and life sciences is shallow and he only writes to hear himself talk – or in this case – type. And he will re-write history to suit his arguments and not care how far from reality he is. All that matters is that in the fantasy world of his mind, he is “winning the argument.”

        As someone wise once said: “you cannot reason someone out of a position that reason did not get them into.”

        • That’s one way to rationalize being on the theistic, i.e., the losing, side of the argument. Blind faith got you into theism, and blind faith will keep you stuck there.

          Fantasies of “God-specified information in DNA” won’t help you out.

        • [][]“Do not waste your time debating …”[][]

          Come to think of it, that is the proper approach to theism. To try to debate theism, to try to justify it scientifically, ought to be considered blasphemy.

          Theism ought to be strictly a matter of faith, accepted blindly — without argument — and absent worldly cares like science and logic.

          Reason cannot get you into theism. It could get you out, but that would require giving up religious faith. That’s a step many may not be willing to take. And why on earth should they?

          • Edward Peltzer

            Steve:

            Thanks for making my case for me. With your every post your un-reason and blind allegiance to non-theistic materialism grows ever more apparent. It makes me wonder why you seem so intent on always having the last word in every exchange. Is there some deep-seated insecurity perhaps? A lack of confidence in your position?

            It is no matter really. As long as you continue to parry every comment it is clear that you are not seeking an exchange of ideas but only seeking to build a higher wall or dig a deeper moat to keep any and all criticisms at bay.

            A colleague at work pointed out not too long ago that the first step in getting out of a hole, was to stop digging. Until then, there isn’t a rope, ladder or lifeline long enough to reach you.

  • I agree with the rabbi that “scientific atheism” is a mirage (or illusion).

    The term “scientific atheism” makes it sound like science leads to atheism, which is logically backwards. Logically, atheism is more fundamental than science.

    Science cannot lead to atheism, but can only build on it — in the sense that science deals with what exists in the world, and does not allow for fantasies such as theism.

    You don’t need science to be an atheist, and theism cannot logically lead to science (or tolerate it).

  • I STARTED READING THE TENNIS CHALLENGE ABOVE AND I ADD:
    Thank hashem that I believe in ONE G’D OF EVERYTHING’
    and I dont have to enter into this debate.Life is so simple as a believer and i have studied G’D to a small degree and now, to a degree…
    I DO SEE THE MIRACLES OF HASHEM. JEWS DO STILL EXIST IN THE WORLD INSPITE OF THE ATHIESTS THE HELLENIST, THE ROMAN EMPIRE, THE MISSIONARIES FROM ESAUV AND THE CHILDREN OF YISMAEL THE ARABS.
    B’H

  • >The trump card that is consistently and triumphantly played by most modern “militant” atheists is Science.

    So much stupid in a single sentence it’s almost artistic if not efficient.

    No, the trump card played by all atheists is “There are no such things as gods”. It’s a trump card because every single theist agrees with that statement right up until the point we get to their god. Then suddenly all the reasons to reject Zeus, Odin, Rangi, Nzame, Feathered Serpent and somee 4,000 other gods become inoperable.

    That clearly shows just how nonsensical it all is because either they’re all real or none of them are.

    And no Mushe, the fact that there are Jews around today does not prove that your god is real. That could serve if Jews were the only ones on planet Earth but fortunately for the wine-tasting community that isn’t so.

    >modern “militant” atheists

    Why the quotes? Are you saying they’re not really militant? They’re scary militant? What is the difference between a militant atheist and one you can accept? I suspect an atheist that doesn’t tell you what a moron you are for thinking Bronze Age myths to be real would qualify but what about one that tells you politely that maybe myths aren’t true?

    And when did these modern atheists appear? How are their beliefs different from the older models? I’m not sure if there can be much evolution on “There are no such things as gods” other than perhaps “No, really, there are no such things as gods.”

    > Science.

    With a capital S no less! Yes, science that system of thought that has produced real miracles, saved real lives and has expanded our knowledge of the universe well beyond “God did it… with magic!” that you seem to think accurate.

    If we lived in a fair world theists would be denied all fruits of science, you lot would be forced to camp in the wild depending on your god for sustenance while the rest of us went about the work of making humanity better by undoing all the damage your god retardation has wreaked.

    Alas all we can practically do is correct and mock theists until they grow up and or die out, which seems to be happening so let’s keep up the good work!

    • Samuel Johnson

      You say there is no God. Very well. Prove it please. You don’t believe there is a God, but that is just your belief. You haven’t established it as a fact, you merely assert it to be one.

      As to theists being denied the fruits of science, if it weren’t for theists then there would be no science as we know it. That surely has not escaped your brilliant powers of observation.

      • /\/\“… if it weren’t for theists then there would be no science …”/\/\

        We do have science, and it is in spite of theism, not because of it.

        • Samuel Johnson

          Not true. Most of the great pioneers of science were convinced of the existence of a creator, a designer of the incredible complexity and specificity that we call life.

          To deny even this basic truth is an example of disingenious rhetoric, which makes any attempt at discussion useless. I suppose that is the purpose.

          Excuse me for being so blunt, but you seem to have a disregard for an honest discourse.

          Your statements are not scientific, they are merely an assertion of your beliefs, wrapped up in pseudo-scientific language.

          You may indeed hold onto your conviction that your world view is correct, but simply stating your assumptions as if they were facts is not science.

          Simply by calling your belief system, your religion if you will, “science”, does not make it any less of a religion or belief system.

          In truth, you are no less religious than the people you deride as delusional dreamers.

          • [][]“Most of the great pioneers of science were convinced of the existence of a creator,…”[][]

            That is certainly true.

            Those pioneers (as well as many people since) were either theists who were part-time scientists, or scientists who were part-time theists. To the extent they were scientists, they were not indulging in full-time theism.

            You can either “do science” or “do theism” but not both at the same time and in the same respect. All the science that got done, got done in spite of religion, not because of it.

            And don’t close your eyes to the history involved, where it was theists who banned books and burned people at the stake; it wasn’t scientists doing that. It was the theists who wanted to make discussion useless — the scientists, on the other hand, wanted to make it useful.

          • {}{}“Excuse me for being so blunt,…”{}{}

            Blunt instruments do have some applications, I suppose, but in science, at least, it is better to be sharp than to be dull.

            {}{}“In truth, you are no less religious than the people you deride as delusional dreamers.”{}{}

            You’d be surprised at how much less religious I am than people who believe in the supernatural. (Not pleasantly surprised, I would venture to say.)

      • >You say there is no God. Very well. Prove it please.

        You say there is no unicorn. Very well. Prove it please.

        You say there is no Vishnu. Very well. Prove it please.

        You say there is no fire breathing dragons running thought the subway system in New York City. Very well. Prove it please.

        Do yo understand now how worthless that argument is?

        >You don’t believe there is a God, but that is just your belief. You haven’t established it as a fact, you merely assert it to be one.

        You don’t believe there is a Zeus, but that is just your belief. You haven’t established it as a fact, you merely assert it to be one.

        See? No matter what you say about your god I can pop in something that there is equal proof of like another god or some other mythical entity.

        >As to theists being denied the fruits of science, if it weren’t for theists then there would be no science as we know it.

        Nonsense. The reason why many of the first scientist were theists was because learning and reading was limited to that and the upper classes.

        If religion hadn’t held back reason with superstitious balderdash we would be that much further ahead.

        Here’s a little project for you, check the education levels of any given nation, check the theism levels, notice any correlation?

        • Samuel Johnson

          The Rabbi must be quite pleased with the discussion here, as it demonstrates the scientific pretentions of militant atheism in action.

          Once again, if one wishes to claim scientific basis for ones beliefs, then merely asserting or assuming to be factual does free one from the obligation of proof. Stating something as being obvious is not a scientific statement.

          Current scientific opinion holds that we live in 10 dimensions, four of which we can directly experience. That is exactly what Nachmanides concluded in the 12th century based on the book of the Torah.

          In Epesians, 3:18, the Apostle Paul described the need to comprehend the essential experiencial meaning of existance using four dimensional units of measurement.

          Current scientific opinion also holds that we live in a virtual reality or digital reality. Our universe is mearely a part of a larger unseen reality. That is exactly what the bible teaches.

          • So that would be you’re not going to address my rebuttal of your very clever “Prove god DOESN’T exist!!!” point?

            See? This is what makes you a theists, I showed you exactly how you were wrong and you just whistled past it as if nothing was said at all.

            I have to admit this could be the first time a theist has credited their Children’s Treasury of Myths with discovering quantum theory so you do get points for originality but lose several thousand for being a silly person.

            But really just more “god of the gaps”, yes there are things we don’t know but what we do know is there are no such thing as gods, certainly not one that spend 14.5 billion years making the universe and then claiming to have done it in 6 then goes on to demand foreskins.

            Talk about obvious!

          • “See? This is what makes you a theists, I showed you exactly how you were wrong and you just whistled past it as if nothing was said at all.”
             
            Heh! It’s frustrating, isn’t it salvage? Trying to explain to someone something that you think is so obvious but they just can’t grasp what you’re trying to say. Kinda like you and Steve not being able to grasp basic biochem. No biggie. I don’t lose sleep over it.
             
            The only difference is that we’re right and you’re WRONG!
             

        • Samuel Johnson

          Just for the record, studies show that the level of scientists who believe in God has not changed significantly since 1916. 40% said they believe and 45% said they did not.

          To your point that educational levels correspond to the lack of belief in a creator, one can only conclude that you are declaring the takeover of the American education system by secular humanists to be a failure, since 93% of all Americans still believe in God.

          Just because you don’t agree with me does not make my argument worthless, any more than the intrinsic value of your argument can acquire value simply by repeating it as if it was already established.

          Point in case, is there a Vishnu? I don’t know. I don’t believe that there is, but perhaps I could be mistaken. Can I prove my assumptions? No I can’t, therefore the hypothesis remains unproven.

          That is at least a valid scientific statement, in contrast to the circular reasoning and disingenuous rhetoric with which you are attempting to bulldoze your opinion through.

          All questions of science aside, what you as an atheist cannot understand is that God revels himself to those who seek Him. The reason people believe in God is because they have a connection to Him at some level, to some degree.

          How people use and develop that connection is completely up to them, but it is real as the frequency reaction which we perceive as our physical reality.

          No oppressor will ever be able to extinguish that spark.

          I leave you with a quote from Einstein, “Then there are the fanatical atheists whose intolerance is the same as that of the religious fanatics, and it springs from the same source . . . They are creatures who can’t hear the music of the spheres”.
          (The Expanded Quotable Einstein, Princeton University Press, 2000 p. 214)

          • [][]“God revels himself to those who seek Him.”[][]

            Just so. That is the only way it can work, since God is a figment of the imagination. God is not really out there (not even way, way out there — beyond reality). God is fantastic, not actual.

        • Samuel Johnson

          6 days, 14.5 billion years. Check that with an expansion factor for the Universe of ten to the twelfth, and see what you get.

          Better yet read Gerald Schroeder’s Genesis and the Big Bang. Surely you know who he is. PhD MIT, Physicist, helped develop the atomic bomb, etc.

          The fact is that science can’t answer the fundamental philosophical questions that militant atheism would have us believe are so matter of fact.

          I quote David Berlinsky:

          We seem to live our lives in perfect indifference to the Standard Model of particle physics…

          Over there, fields are pregnant with latent energy, particles flicker into existence and disappear, things are entangled, and no one can quite tell what is possible and what is actual, what is here and what is there, what is now and what is then…

          Time and space contract into some sort of agitated quantum foam. Nothing is continuous. Nothing stays the same for long, except the electrons… A pointless frenzy prevails throughout.

          Over here, space and time are stable and continuous. Matter is what it is, and energy does what it does. There are solid and enduring shapes and forms… Changes appear slowly, but even when rapid, they appear in stable patterns. There is dazzling variety throughout. The great river of time flows forward. We anticipate the future, but we remember the past. We begin knowing we will end.

          The God of the Gaps may now be invited to comment-strictly as an outside observer, of course. He is addressing us.

          And this is what He has to say: You have no idea whatsoever how the ordered physical, moral, mental, aesthetic, and social world in which you live could have arisen from the seething anarchy of the elementary particles.

          It is like imaging sea foam resolving itself into the Parthenon.

          And even though He is speaking strictly as an observer, perhaps He will be forgiven for asking of Christopher Hitchens, (or Steve Stoddard) who has wandered into this discussion prepared to dispute anyone at the bar, “Where wast thou when I laid the foundations of the earth? Declare, if thou hast understanding.”

          David Berlinsky, “The Devil’s Delusion”, page 200-201

  • [][]“There is no physical or chemical law that dictates the relationship between the nucleobases and the amino acids for which they code. This is directly analogous to the fact that there is no physical or chemical connection between the words and letters we use to describe ideas and the words and the ideas themselves.”[][]

    In that formulation, Rabbi Averick, the “DNA code” is a metaphor for the expression of ideas, instructions, or information — not an actual expression of thought and design. People think and design — that’s why we have words and letters. DNA doesn’t think or design — that’s why DNA has no code.

    DNA is surely complex and specific — but it is in no way designed and specified.

    • Samuel Johnson

      DNA has no code? Then please define code.

      DNA is code. In fact, it is a self replicating and error correcting code.

      If DNA is not code, then what is it?

      • The plain fact is that DNA existed long before anyone capable of creating or understanding any kind of code ever evolved.

        You are trying to put the cart before the horse.

    • Perhaps that’s been the problem all along, theists can’t tell metaphor apart from the literal leading to a deep confusion about reality.

      • moshe averick

        Unsalvageable,

        In fact you are not brave at all. You are quite the coward.

        Nearly all atheistic philosophers and thinkers, Sartre, Nagel. Ruse, Provine, Freud, et al, admit that in an atheistic world life has no inherent meaning or purpose.
        They tell us that we have to create our own meaning. When stripped of its philosophical window dressing what this means is that you have to make something up that gives your life purpose and pretend it’s real. In other words convince yourself that your fantasy version of meaning actually has real significance.

        Wow, that’s really bold!

        • [][]“… you have to make something up that gives your life purpose and pretend it’s real.”[][]

          That is the role of religion in life.

          Theism is the pursuit of a fantasy version of meaning in life, substituting imaginary commandments from Something unnatural in place of pursuits of real significance.

        • [][]“… in an atheistic world life has no inherent meaning or purpose.”[][]

          Since by “inherent” you mean “supernaturally commanded,” then you are more or less correct: in a world without a Supernatural God, there are no Commandments From God.

          But your premise that “without God, life can have no meaning or purpose,” is irrational. It is certainly not supported by real world experience. Feeling strongly that you need God to give your life meaning is not proof that the unreal/supernatural actually exists.

        • >In fact you are not brave at all. You are quite the coward.

          AHAHAHAH! I KNOW YOU ARE BUT WHAT AM 1?!?!

          Really Mushe? Is that the best you can do? Again you demolish the stereotype of the witty and wise Rabbi.

          >They tell us that we have to create our own meaning.

          Quite right. And look at you, talking about them and their ideas so obviously their lives had meaning and impact. They created new thoughts, new beliefs, new ways of looking at the world whereas you and your fellow travelers are far too chickensh*t to do so, they explored undiscovered country, you’d rather wallow in the safety of ancient myths.

          Reality waaayy too scary for your lot.

          >When stripped of its philosophical window dressing what this means is that you have to make something up that gives your life purpose and pretend it’s real.

          Once again Mushe you mix projection and irony to a degree not seen since Imax ran a Coen Brothers film festival.

          So my work, the people in my lives, the way I try and improve myself and my world are not real? Funny, they sure seem that way!

          Yet your god, the weird one that let a talking snake trick his greatest creation into wrecking its prefect paradise, then went on to demand wars and foreskins, not before flooding the planet in a rage (but saving humanity by telling a drunk to build an ship to hold all the Earth’s animals in a feat of engineering that would be impossible in any era much less one before steel) and all sort of other crazy things is real?

          See Mushe this is why I call you delusional and mock accordingly, you clearly cannot separate reality from fantasy.

          Me. Real. My life. Real. Your god. Not real. Myth. And if you actually read your Torah you’d know that but I suspect you skip those early passages that make it pretty clear.

          >In other words convince yourself that your fantasy version of meaning actually has real significance.

          Ha! Ha! Yes! I have to convince myself that my life, the people in it, the ways I’ve improved it are all real! It take such willpower to believe in things I can see, touch, hear, record and otherwise experience. What make it even harder are all the people around me confirming it, how do I stay in such a fantasy?!!? I tell you it’s a good thing I did a lot of drugs in the 80s… and 90s… and um whatever we’re calling the last decade cuz I sure need the foundation of altered states to manage that trick!

          >Wow, that’s really bold!

          Oh Mushe, you’re such a wimp in so many ways. You have no original thoughts, not even a unique idea, you rehash the same nonsense that theists have been babbling about since forever.

          That takes no courage.

          It’s all laid out for you in easy to follow steps. You have no difficult questions to answer, no hard choices to make, you think your back is being watched by an omnipotent supernatural entity who is going to eventually reward your faith. You bask in the respect of your community based solely on your title that you earned by just memorizing the right bits of books and answering rote questions.

          That’s the safest path in life anyone could take, well worn, well lit and with a clear final destination of fabulous prizes.

          Real life is something you could not even begin to handle.

    • Samuel Johnson

      Ever heard of Sir Isaac Newton? Would you define him as a part time scientist? Fact is, he wrote more about his belief in God than on any other topic. Would you deny his brilliance or his contribution to modern science?

      Atheists burn books and people quite well, thank you. Fanaticism and brutality are not limited to theists, nor are they excluded simply by placing a “a” at the front of your title.

      More people have been murdered in the 20th century than all others combined. Ever heard of Stalin or Pol Pot? How many people are being systematically exterminated in North Korea every year? And please don’t tell me Hitler was a Christian. He was anything but.

      As to your assertion that scientists never committed atrocities, or inflicted harm? Who are you kidding? Do you really believe this drivel, or is it just a point of pride not to concede even the simplest statement of truth?

      So you don’t believe in God, that’s no big deal, but please stop pretending your arguments as to why one should not believe in God are based on logic and reason.

      • [][]“Ever heard of Sir Isaac Newton? Would you define him as a part time scientist? Fact is, he wrote more about his belief in God than on any other topic.”[][]

        Clearly Newton was only a part-time scientist, since he wrote more about his belief in the supernatural than he did about nature (if your analysis is to be believed).

        [[]]“Would you deny his brilliance or his contribution to modern science?”[[]]

        No, naturally not. Newton was certainly brilliant when he didn’t turn off his mind to indulge supernaturalist fantasies, but paid attention to reality instead.

      • [][]“… in the 20th century …”[][]

        You need to decide which century you would like to discuss. They aren’t all the same, and you cannot reasonably switch centuries just because it feels convenient.

        You started talking about the “pioneers of science” — and that means pre-Enlightenment figures such as Archimedes, Copernicus, and Galileo. By the 20th century, science was already long-established (even to the point of being somewhat corrupted by statist political forces looking to return us to the Dark Ages, e.g., Pol Pot, the “Green Movement,” etc.).

  • I wonder if the author realizes just how decidedly this article exposes his lack of scientific knowledge. The theory of evolution is in now way shape or form the “foundation stone” of the scientific method. In fact, if someday the empirical evidence where to falsify this theory, the scientific community would gladly and excitedly move away from it and unto the next hypothesis that improves upon it and more accurately describes the facts of life on Earth (same goes for the theory of gravity, etc). Science is not pinned to any one theory.

    Moreover, the theory of evolution only addresses the diversity of life on Earth. It doesn’t address the origin of life on Earth, much less the origin of life in the Universe or the origin of the Universe itself.

    I feel for folks like the author that still struggle with these basic concepts and I will do everything I can to ensure that the youth of today is introduces to the critical thinking skills that will allow them to grasp these basic concepts and live a life that is much more grounded in reality and abandons the chains of superstition and religious indoctrination that bound the author and his followers.

    • Lightnin,

      Puzzled by your remarks. If you will look at the article again you will see clearly that I never said that evolution was the foundation stone of the scientific method. I said it was the foundation stone of a “science-based atheistic world view.” That is very different than saying it is the foundation of the “scientific method.” It’s hard for me to understand how you made such an error.

      “It doesn’t address the origin of life on earth.” That very point was one of the main points of my article. It seems you did not read very carefully. could you please explain?

      • \\\… I never said that evolution was the foundation stone of the scientific method. I said it was the foundation stone of a “science-based atheistic world view.”///

        As I understand it, Averick and Dawkins agree on this point — but I don’t buy it.

        I was neither born nor bred as an atheist, but I did decide to be one — and that was well before I knew anything about evolution. In fact, I am still an atheist to this day, and I wouldn’t really say that my understanding of evolution amounts to a hill of beans. One does not really need to know anything about how (or even if) evolution really works in order to be an atheist. One simply needs to understand the basic point that nature necessarily exists while the supernatural necessarily doesn’t.

    • Lightnin,

      Puzzled by your remarks. If you will look at the article again you will see clearly that I never said that evolution was the foundation stone of the scientific method. I said it was the foundation stone of a “science-based atheistic world view.” That is very different than saying it is the foundation of the “scientific method.” It’s hard for me to understand how you made such an error.

      “It doesn’t address the origin of life on earth.” That very point was one of the main points of my article. It seems you did not read very carefully. could you please explain?

      • [\\\… I never said that evolution was the foundation stone of the scientific method. I said it was the foundation stone of a “science-based atheistic world view.”///]

        As I understand it, Averick and Dawkins agree on this point — but I don’t buy it.

        I was neither born nor bred as an atheist, but I did decide to be one — and that was well before I knew anything about evolution. In fact, I am still an atheist to this day, and I wouldn’t really say that my understanding of evolution amounts to a hill of beans. One does not really need to know anything about how (or even if) evolution really works in order to be an atheist. One simply needs to understand the basic point that nature necessarily exists while the supernatural necessarily doesn’t.

    • Samuel Johnson

      Empirical evidence? Please provide an example where the “evolution theory”, as you so rightly name it, has been “proven” using empirical evidence.

      Your observation that the “scientific community” would “gladly and excitedly move away” from Darwinism fails to mention that many scientists have already moved away from it.

      What you really seem to be saying is that atheists would be happy to have an viable argument other than Darwinism at their disposal, but at the moment it is the best they can do.

  • Thank you Mr Stoddard for taking the trouble to help us many non-scientists to better understand some of these difficult questions. Please keep up your good work.

    • It is not a scientific issue at all. The Creationists do tend to try to cast it as a “science vs. religion” deal, but that’s not what it is. It is really a religion (i.e., blind faith) vs. understanding (which includes science as a part, but not the whole) conflict.

    • The famous “Argument from Design” is merely a form of the assumption of the existence of God.

      It is simply an expression of blind faith, not any sort of reasonable argument.

  • {}{}“The task of Origin of Life researchers would then be to figure out the purely naturalistic, unguided process that transformed mud, rocks, and straw into a habitable mud hut.”{}{}

    That’s a big job, but somebody needs to do it. Throwing up your hands and pleading ignorance, i.e., theism, is a gross dereliction of duty in real life.

  • Brian Westley

    “There is an enormous spiritual gulf between a nation that views human life as reflecting a transcendent, sacred reality, that cherishes the concept that all men are created equal and have been endowed by their Creator with unalienable rights and one that believes that homo sapiens are essentially highly developed bacteria or chimpanzees that evolved through an unguided, purposeless process. It is one or the other; there is no middle ground here.”

    Yawn, false dichotomy.

    • Both of those proposed option are false. That is, it is neither true that there is such a thing as “transcendent, sacred reality” — as opposed to actual reality — nor that humans are “essentially highly developed bacteria” — as opposed to actual human beings.

    • [][]“The awe inspiring complexity of every aspect of the living world is, at first glance, a glorious testimony to a Creator. This is not in dispute.[][]

      So claims Rabbi Averick.

      In other words, there is no dispute over the fact that theists actually exist. They certainly do. It is God that doesn’t actually exist. Outside fiction.

      • Steve,

        So claims Averick and so agrees Dawkins, you would have known that if you bothered reading the article carefully. Sorry Steve, But an Averick and a Dawkins trumps a Stoddard any day of the week.

      • Steve,

        So claims Averick and so agrees Dawkins, you would have known that if you bothered reading the article carefully. Sorry Steve, But an Averick and a Dawkins trumps a Stoddard any day of the week.

      • Steve,

        So claims Averick and so agrees Dawkins, you would have known that if you bothered reading the article carefully. Sorry Steve, But an Averick and a Dawkins trumps a Stoddard any day of the week.

        • [][]“But an Averick and a Dawkins trumps a Stoddard any day of the week.”[][]

          No, Rabbi Averick, human understanding doesn’t work that way. The larger contingent is not necessarily correct. Reason trumps faith, and facts trump fantasy. Nature exists, the unnatural doesn’t — regardless of how anybody feels about Darwin, Dawkins, or Averick.

        • Even if you add in a Rex, you still can’t get a winning hand. In fact, no matter how large a group you can claim for theism, you still cannot rescue God from His Fictional Status.

  • UsingReason

    “The foundation stone upon which rests the entire edifice of a science-based atheistic world view is the truth of Darwinian evolution.”

    Nope, Atheism is based on the complete and total lack of evidence for the existence of god(s). If tomorrow, evolutionary biology was proven to be entirely wrong in every way it does not make the existence of god any more likely; in any way. There is no verifiable evidence that indicates a god exists.

    • There is no possibility that anything supernatural exists. So naturally there is no evidence for “a god,” not even of any kind.

      “Verifiable evidence” is a concept that deals with reality, not fantasies of “the supernatural.”

    • [][]“The foundation stone upon which rests the entire edifice of a science-based atheistic world view is the truth of Darwinian evolution.”[][]

      That’s not exactly true.

      Science is not based on the truth of any particular scientific theory. Science isn’t based of the truth of any particular group of scientific theories, for that matter.

      And atheism isn’t based on science.

      Both science and atheism are based on the same fundamental fact, viz., that nature is real (and the “supernatural” isn’t).

    • [][]“the Argument from Design has yet to be challenged in any serious manner by modern science.”[][]

      There is nothing scientific about the “Argument from Design,” so there is nothing for modern science to deal with there.

      The argument that there is Supernatural Design in nature which proves there is a Supernatural Designer is vacuously circular.

    • Using Reason,

      Perhaps you should use your reason to explain why Dawkins completely rejects your understanding of atheism. Without Darwinian evolution to explain the diversity and complexity of life, atheism would be a rather weak and unattractive world view.

      • [][]“Without Darwinian evolution to explain the diversity and complexity of life, atheism would be a rather weak and unattractive world view.”[][]

        Nonsense.

        Nature is precisely what it is, regardless of whether anyone believes in God or not. Nature doesn’t magically change according to whether one is a theist or an atheist.

        If theists feel that nature just isn’t enough for them, and they they need an imaginary ruler in heaven to tell them how to live … well, that certainly doesn’t make life bleak for any atheist who doesn’t share the “weak and unattractive world view” of the theists.

      • [][]“… the Argument from Design … was the undeniable evidence for the existence of a Creator of life.”[][]

        The “Argument from Design” was never any sort of evidence for the existence of God (and certainly not “undeniable evidence”!). It’s not even really an argument. That so-called “Argument” is merely an assumption that God exists, based on the feeling that it would be quite something if God did miraculously exist.

        The assumption is absolutely wrong, but that is of little account to those of blind faith. For theists, faith trumps reason.

      • >atheism would be a rather weak and unattractive world view.

        Uh no, there were atheist before Darwin and there would be atheists without Darwin.

        You really live in a world of your own making don’t you?

        And weak? Rabbinical, please. Theism is the choice of the weak. Life it too hard to handle without a supernatural daddy who agrees with you on every cultural and political point, who looks out for you and will reward you someday for your blind faith.

        Realizing that we’re on our own? That we have this tiny short time to live in a mind that can see infinity? That we know that there isn’t a cosmic ledger that will pay off on our good deeds at the end? Matzoh balls of steel need only to apply.

        • Samuel Johnson

          I stand in awe of your brave mind looking out on infinity without the comfort of a supernatural daddy!

          When I think of all those spineless weaklings who came before us, sadly lacking your interpid insight and strength. Pioneers, inventors and discoverers? Building civilations and nations? Humbug. Weaklings, all!

          Just imagine what they could have achieved, if only they knew, as you do, that their very existance was a meaningless coincidence, void of purpose.

          Imaagine, what a world that would be.

          Knowing that there is no truth, the powerful would finally be free to enforce their will without those pesky weaklings standing up to fight back.

          • [][]“… without the comfort of a supernatural daddy …. their very existance was a meaningless coincidence, void of purpose.”[][]

            It gives your game away when you take the “meaningless void” tack about the nature of life. When you feel that your life would be “a meaningless coincidence, void of purpose” if you didn’t give yourself the comfort of believing in the supernatural, then you are not logically entitled to conclude that everyone else shares your feelings.

            You seriously need to consider that at least some atheists understand that purpose in life does not have to be an imaginary gift (or commandment) from Something unnatural.

          • >I stand in awe of your brave mind looking out on infinity without the comfort of a supernatural daddy!

            Well I am pretty awesome but really it’s not that big a deal, lots of people do it.

            >When I think of all those spineless weaklings who came before us, sadly lacking your interpid insight and strength. Pioneers, inventors and discoverers? Building civilations and nations? Humbug. Weaklings, all!

            No, I’m sure many were atheists and being a theist doesn’t mean you can’t do things that take courage, it means you think that there is a god looking out for you and your own and when you die it will take care of and reward you. Are you saying that doesn’t bring a great deal of comfort?

            >Just imagine what they could have achieved, if only they knew, as you do, that their very existance was a meaningless coincidence, void of purpose.

            That might be your existence, mine is nothing of the sort.

            So, if your god isn’t real than you’re a meaningless coincidence? And that would be bad huh? See? You’ve just proven my point about how theists desperately need their gods and can’t go on without them.

            >Imaagine, what a world that would be.

            People living life and not steeped in mythological based ignorance? It’d be great.

            If you want to know what the world looks like soaked in theism check out Europan history from 300 to 1,700, a real peaceful paradise that was!

            >Knowing that there is no truth, the powerful would finally be free to enforce their will without those pesky weaklings standing up to fight back.

            So, your god is “the truth” and theism is the only thing preventing anarchy?

            Wow, you really showed me that religion doesn’t make you feel safe and secure!!

            If you were a Brazilian soccer player, a fan would be shooting you right now for such a sloppy “own goal”.

  • Nature has various structures and processes in it, and it’s all 100% natural. It couldn’t be any other way. That’s the “level playing field” we all live on.

    The belief that nature is just a bubble within a larger unnatural realm (the unlevel, unreal supernature of God) makes no sense — but then it doesn’t have to since it is only a fantastic fictional creation.

    So why, Rabbi Averick, do you restrict your “specified information” argument to DNA? Why don’t you argue that there is “specified information” in all atoms — which you could then take as proof that God created everything (not just life)?

    The “specified information” argument applies equally well to elementary atoms as it does to DNA. After all, we never encounter water made up of carbon and helium atoms — and that is largely due to the “specified information” in the electron shells of the various atoms. Can that be explained by anything other than a “Supernaturally Intelligent Designer”?

    • Steve,

      Hydrogen and Oxygen are not “codes” that represent ideas, instructions, or information. They just happen to combine in a certain way. Nucleobases are arranged in a specific order and it is this specific order that represents the coded instructions which are retrieved by messenger RNA and then translated by transfer RNA and Ribosomes. As Francis Crick described it in his book Life Itself- Messenger RNA is a molecular information tape. There is no physical or chemical law that dictates the relationship between the nucleobases and the amino acids for which they code. This is directly analogous to the fact that there is no physical or chemical connection between the words and letters we use to describe ideas and the words and the ideas themselves. They can just as easily be explained and spoken in a different language with different sounds and words. That is what coded information is. The code is arbitrary, the information is specific.

      • [][]Hydrogen and Oxygen are not “codes” that represent ideas, instructions, or information.[][]

        Naturally not. They are not “codes” any more than DNA is.

        DNA does not “represent ideas, instructions, or information.”

      • [][]“Nucleobases are arranged in a specific order and it is this specific order that represents the coded instructions …”[][]

        That is no more true than claiming that “electrons in atoms are arranged in a specific order and it is this specific order that represents the coded instructions …”

      • [][]“Hydrogen and Oxygen just happen to combine in a certain way.”[][]

        Correct. And that is equally true of the A-T and C-G pairing in the DNA spiral.

        It’s quite natural.

        There is absolutely nothing unnatural about it at all.

  • [[]]“However, let the discussion be an honest one with a level playing field.”[][]

    Reality qualifies as a “level playing field,” but the supernatural is a total tilt away from reality.

    The whole point of blind, i.e., religious, faith, is to try to put the discussion on a terribly non-level (i.e., unnatural) playing field.

    “Creation, by God! is fiction — so in that sense it is nowhere near the playing field of knowledge in the first place. Trying to tilt the playing field to include “God the Creator” is unreasonable in the extreme.

    • Rabbi Averick criticized the idea that “… the believer is mired in the quicksand of superstition, wishful thinking, and leaps of faith.”

      Yet it is really true that theists don’t have a reasonable leg to stand on in trying to argue against unbelief in the unnatural.

Leave a Reply

Please note: comments may be published in the Algemeiner print edition.


More...

  • Personalities Sports NBA Finals a Time to Remember Legendary Jewish Coach Red Auerbach

    NBA Finals a Time to Remember Legendary Jewish Coach Red Auerbach

    JNS.org - At the start of each nationally televised game of the 2013 NBA Finals between the San Antonio Spurs and the Miami Heat, ABChas aired a film-clip montage of basketball’s great players and coaches—a montage that includes Jewish coach Arnold “Red” Auerbach, the mastermind behind nine championship teams for the Boston Celtics. Red was one of four children of Marie and Hyman Auerbach. Hyman was a Russian-Jewish immigrant who left Belarus when he was 13. The couple owned a deli and [...]

    Read more →
  • Arts and Culture Jewish History The Marx Brothers and Jewish Identity

    The Marx Brothers and Jewish Identity

    JNS.org - The sons of Jewish immigrants from Germany and France, the Marx Brothers became zany masters of stage and screen who continue to captivate audiences. But in addition to providing comic relief, their films captured the drama of the entry of their marginalized religion into the U.S. Wayne Koestenbaum, author of the 2012 book The Anatomy of Harpo Marx, explains that the Marx Brothers’ Jewishness as a family “was evident, marked, thoroughly legible.” “Within a family already marked as Jewish within [...]

    Read more →
  • Arts and Culture Jewish Identity SuperJew

    SuperJew

    For my shekels, the question of whether the comic book character Superman, is Jewish or not shouldn’t even be questioned. Born and named Kal-El by his father Jor-El, “El” is one of the ancient names for God used throughout the bible and found in great prophets such as Samue-el, Dani-el and angels Micha-el and Gavri-el and of course, Isra-el. As Simcha Weinstein in his entertaining book, “Up, Up And Oy Vey” points out, “Kal” is the root of several Hebrew [...]

    Read more →
  • Israel Sports Formula 1 Road Show Thrills Jerusalem

    Formula 1 Road Show Thrills Jerusalem

    JNS.org – Some 100,000 people attended Israel’s first-ever Formula 1 Road Show in Jerusalem on Thursday and Friday. For several hours, the controversies that normally characterize Jerusalem were put aside, and a diverse mosaic of Israelis watched up close as the motor-sport stars temporarily conquered the city. “It was an amazing experience, the most fast and furious thing I have seen,” spectator Masada Porat told Israel Hayom. “It was a rare, extreme event that explodes in your face.” Spectator Irena [...]

    Read more →
  • Book Reviews Jewish Identity Klara’s Journey Casts Jews in Fast-Paced Adventure Through Russian History

    Klara’s Journey Casts Jews in Fast-Paced Adventure Through Russian History

    JNS.org – “If you’re sick, move away. Have some consideration for others,” a red army soldier scolds a slow-moving old man selling train tickets. “No, fires back the old man, proud, haughty, not realizing it’s a new country, a Bolshevik country where force heads the list instead of civility,” reads the following line in Ben G. Frank’s new novel, Klara’s Journey, released June 1. Reminiscent of Boris Pasternak’s Dr. Zhivago—whose backdrop is also a train ride across the Russian frontier during the [...]

    Read more →
  • Personalities Theater Nora Ephron, Famed Jewish Screenwriter, Remembered Through Tribeca Film Festival Prize

    Nora Ephron, Famed Jewish Screenwriter, Remembered Through Tribeca Film Festival Prize

    JNS.org – For filmmaker Meera Menon, no honor could have been more fitting than winning the inaugural award named after famed Jewish screenwriter and novelist Nora Ephron, the woman whose work inspired her. At the recent 2013 Tribeca Film Festival, Menon was named the first recipient of the $25,000 Nora Ephron Prize, given to a writer or director whose work embodies that of the late Ephron, who wrote the scripts for a number of hit films, including “When Harry Met [...]

    Read more →
  • Book Reviews Personalities Book Review: ‘Jewish Jordan’ Memoir an Important Guide for Players and Coaches

    Book Review: ‘Jewish Jordan’ Memoir an Important Guide for Players and Coaches

    JNS.org – Despite his friends’ and family’s doubts that a young Orthodox Jewish athlete could ever play college or professional basketball without compromising his religious values, between 1999 and 2009 the “Jewish Jordan” defied conventional wisdom and found his place on the court. In his new memoir, Jewish Jordan’s Triple Threat, Tamir Goodman describes his triumphs and disappointments in life, crediting his practice of Judaism for shaping his identity as an athlete and his understanding of basketball as a team sport. [...]

    Read more →
  • Blogs Sports Omri Casspi, ‘Jewish Jordan’ Partner on Basketball Camps to Inspire Youths On and Off the Court

    Omri Casspi, ‘Jewish Jordan’ Partner on Basketball Camps to Inspire Youths On and Off the Court

    Tamir Goodman (left) and NBA forward Omri Casspi—pictured on the court of the United Center, home of the Chicago Bulls—together run basketball camps that seek to inspire youths on and off the court. Photo: Courtesy Tamir Goodman. JNS.org – Before last year, basketball camps for Jewish youths never had an instructor quite like Omri Casspi, a forward for the National Basketball Association’s (NBA) Cleveland Cavaliers and the first Israeli-born player in NBA history. Casspi is a de facto ambassador for [...]

    Read more →
Sign up now to receive our regular news briefs.